Biological Science (7th Edition)
7th Edition
ISBN: 9780134678320
Author: Scott Freeman, Kim Quillin, Lizabeth Allison, Michael Black, Greg Podgorski, Emily Taylor, Jeff Carmichael
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 17, Problem 10TYPSS
Summary Introduction
To review:
The maximum rate of translation by a ribosome in a bacterial cell. To calculate the time period taken by the bacterial cell to translate an mRNA (messenger ribonucleic acid) containing 1800 codons.
Introduction:
The transcriptional and translational rates should proceed at a controlled rate to avoid collisions between the ribosomes and the RNA polymerases. The transcription rate of RNA polymerase into mRNA is 60
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Recall from the central dogma that DNA codes for mRNA, which then codes for
protein. Also recall that directionality matters!
DNA 3' TAC - CTA -AAT - TGC - TCG-ATT 5'
mRNA 5' ???- ???- ???- ???- ???- ??? 3'
protein
? ?
? ? ?
(A) Indicate whether the DNA sequence provided is the sense strand or the
antisense strand.
?
that
(B) For the DNA sequence given above, write out the mRNA sequence that results.
(C) Now write the amino acid sequence that results from the mRNA sequence
you wrote in part (B). Use the three-letter abbreviations for the amino acids.
(D) What happens if the A that is bolded and underlined in the given DNA sequence
is mutated (changed) to a C? How is the protein affected? This can be answered in a
few words, but be specific!
(E) Now let's pretend for a moment that the protein being affected is ATP-ADP
translocase. What, if anything, would happen to the citric acid cycle? This should be
answered in a few words/one sentence max.
Suppose RNA is synthesized in vitro using the polynucleotide phosphorylase enzyme with a 3:1 ratio of C and G nucleotides (3C:1G ratio). If you were to use the resulting RNA to synthesize protein in an in vitro translation system, what percentage of the total amino acids in the protein would be made up of alanine (Ala)?
56.25%
6.25%
18.75%
0%
14%
Transcription occurs at a rate of about 30 nucleotides per second. is it possible to calculate the time required to synthesize a titin mRNA from the information given here?
Chapter 17 Solutions
Biological Science (7th Edition)
Ch. 17 - Prob. 1TYKCh. 17 - Prob. 3TYKCh. 17 - Prob. 4TYKCh. 17 - 5. RNases and proteases are enzymes that destroy...Ch. 17 - Prob. 6TYUCh. 17 - The nucleotide shown below is called cordycepin...Ch. 17 - Prob. 10TYPSSCh. 17 - What better not be for dinner? Eating even a...Ch. 17 - 12. α-Amanitin inhibits transcription by binding...Ch. 17 - Prob. 13PIAT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The sequence below shows the non-coding strand from the whole of the transcribed region of a very short gene. 5’-GGCTTCTTTAGTACTGGCCAGTGGGATCCAAGTAGGCTGCCATTTCGT-3’ Write out the sequence of the mRNA from this gene in the orientation 5′ → 3′ and, using the genetic code (see Fig. 1. overleaf) deduce the amino acid sequence of the peptide it encodes (NB you should read about the operation of the genetic code prior to attempting this question).arrow_forwardExplain the function of spliceosomes in eukaryotic cells. The following sequence represents pre-mRNA derived from a gene coding for alpha keratin in birds. Label the sequence to show potential exon(s), intron(s) and spliceosome cut site(s). That is, put the intron(s) sequences in parentheses and use black slash symbols (/) to indicate the spliceosome cut site(s). What is the sequence of the mature MRNA after splicing? [ 5' AUGGGUUUAGGACCCCCGAUAAA 3'arrow_forwardThe flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation initiation sites, overlapping reading frames, and ribosomal frameshifting. For example, part of the viral PA gene includes a rarely used CGU codon. When the ribosome pauses to translate this codon, it may slip ahead by one nucleotide and produce a polypeptide with a diff erent C-terminal sequence. From the partial mRNA sequence shown here, determine the normal polypeptide sequence and the sequence with the frameshift.arrow_forward
- Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forwardI've attached the table of transcription ans translation for a DNA and Bees work, Genes A and B are exons while C is an intron. Gene A has a silent mutation and Gene B has a nonsense mutation. Please answer the below for me The 3 genes code for different proteins: • Gene A = protein essential for stinger • Gene B = DNA replication enzyme • Gene C = fuzzy hair protein Do you think it matters which protein is mutated? Is one protein more important than another? How would you try to help the bees stay healthy using the information from the mutations?arrow_forwarda) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA discuss how that will affect the reading frame and expression product production. Using the following list of codons describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be sure to discuss all steps. In other words, use a diagram and give me sequences, transcription and translation steps. Show the sequences of the sense and the other DNA strand, the mRNA and the tRNA’s. UUU -phenylalanine UCU -serine AUG –initiation/methionine CUU -leucine ACU -threonine GUU -valine UAA -Terminationarrow_forward
- Determine whether each event occurs during initiation, elongation, or termination. Initiation Peptidyl transferase transfers the peptidyl group to water. In E. coli, EF-Tu hydrolyzes GTP. Elongation In E. coli, mRNA binds to the 30S ribosomal subunit. Answer Bank In prokaryotes, the Shine-Dalgarno sequence pairs with rRNA. In E. coli, EF-Tu delivers an aminoacyl-tRNA to the ribosome. Termination Translocation occurs. Initiator tRNA enters the P site.arrow_forwardWhat is the purpose of the underlined sequence? 5’ CAGGGTAGGTACTATGCCTGGATGCCATGGGTAAGGACTAATAAAG 3’ Answer choices The signal to add a 5’ methyl-guanosine cap to the mRNA sequence recognized by the small ribosomal subunit for translation the signal to add a stretch of adenines to the mRNA Sequence that promotes transcription in eukaryotes the recognition sequence for the sigma factor of the RNA polymerasearrow_forward1.) Define transcription and translation. How does transcription and translation differ in prokaryotes vs. eukaryotes (i.e. What is present in one but not the other)? 2.) What it means when we say that genetic code is redundant? 3.) Describe the stages of transcription (in detail for each step) - what components are required? 4.) Describe the stages of translation in eukaryotes (initiation, elongation, termination)arrow_forward
- E22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |arrow_forwardList and briefly explain. C-terminal domain of RNA polymerase II function to ensure that the varoius sets of mRNA processing enzymes carry out their duties at the apporpiate time and place?arrow_forwardThe gene ABCD is 1500 bases long. Answer the following questions: What would be the likely length of the pre-mRNA molecule? What would be the likely length of the mature RNA molecule? What would be the likely length of the protein?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license