Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 14P
| a. | Which genome manipulation technique would you use to create a mouse model for the human disease Leber congenital amaurosis (LCA), described at the very beginning of the chapter? Explain. |
| b. | Which procedure would you use to generate a mouse model for fragile X syndrome, a trinucleotide repeat disease caused by a mutant allele of the FMR-1 gene? (Review the Fast Forward Box in Chapter 7 entitled Trinucleotide Repeat Diseases: Huntington Disease and Fragile X Syndrome.) Explain. |
| c. | Which procedure would you use to create a mouse model for Huntington disease? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?
Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
Mutations in the CFTR gene result in cystic fibrosis in humans, a conditions in which abnormal secretions are present in the lungs, pancreas, and sweat glands. The gene was mapped to a 500-kb region on chromosome 7 containing 3 candidate genes.
a)Using your knowledge of the disease symptoms, how would you distinguish between the candidate genes to decide which is most likely to encode the CFTR gene?
b)How would you prove that your chosen candidate is the CFTR gene?
Chapter 18 Solutions
Genetics: From Genes to Genomes
Ch. 18 - Match each of the terms in the left column to the...Ch. 18 - Mice are usually gray, but a mouse geneticist has...Ch. 18 - Sometimes, genes transferred into the mouse genome...Ch. 18 - In mice, a group of so-called Hox genes encode...Ch. 18 - The fly eyes shown in Fig. 18.7 are malformed...Ch. 18 - This problem concerns a technique called enhancer...Ch. 18 - Fish and other organisms that live in the Arctic...Ch. 18 - a. Describe two ways you could potentially make a...Ch. 18 - Figure 18.6 shows a picture of Glofish ,...Ch. 18 - Some people are concerned about the possible...
Ch. 18 - The goal of the Knockout Mouse Project is to...Ch. 18 - Prob. 12PCh. 18 - Prob. 13PCh. 18 - a. Which genome manipulation technique would you...Ch. 18 - a. Diagram a knockin construct that could have...Ch. 18 - Prob. 16PCh. 18 - Prob. 17PCh. 18 - The transcription factor Pax6 is required...Ch. 18 - Mouse models for human genetic diseases are...Ch. 18 - One way to determine where inside a cell a protein...Ch. 18 - In Problem 5 in Chapter 17, you saw that a SNP...Ch. 18 - Scientists now routinely use CRISPR/Cas9 to make...Ch. 18 - Geneticists are currently considering using...Ch. 18 - a. Figures 18.9 and 18.12 demonstrated methods to...Ch. 18 - Nonhomologous end-joining NHEJ of a double-strand...Ch. 18 - One problem that researchers sometimes encounter...Ch. 18 - Researchers at the University of California at San...Ch. 18 - Prob. 28PCh. 18 - F. Port and S. Bullock at the University of...Ch. 18 - On Fig 18.14, locate the PAM site and identify the...Ch. 18 - Prob. 31PCh. 18 - Prob. 32PCh. 18 - Recall that Leber congenital amaurosis LCA, a form...Ch. 18 - One potential strategy for gene therapy to correct...Ch. 18 - Recently, scientists have used a mouse model for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Describe the methodology that you would use to determine the association between specific sequence variations or epigenetic modifications and observed diseases in humans. Given your newfound knowledge of this association how would you then design a genetic test that could be used to identify individuals within a given population who have developed the disease or at risk of developing the disease. “The disease” here refers to any heritable genetic disease..arrow_forwardYou isolate genomic DNA from brain cells and heart cells and use PCR to amplify the promoter region of gene A, known to be methylated under certain circumstances. To determine which cell type has methylation in this region, you treat the DNA with sodium bisulfite, sequence the regions from both brain and heart cells, and compare to the untreated sequence, as shown below. Untreated: ATCCGGCGACG Brain: ATCCGGCGACG Heart: ATCTGGTGACG Given these results, which cell type would you expect to transcribe MORE "A" mRNA?arrow_forwardThe period gene of Drosophila melanogaster encodes for a stretch of Thr-Gly repeated in tandem. In natural populations, the three most common alleles encode for 17, 20 and 23 Thr-Gly repeats. The amplification by PCR of the allele encoding for 20 Thr-Gly repeats produces a fragment of 320 bp. Using the same set of primers, what is the size expected when amplifying the 17 Thr-Gly allele? 317 303 314 302 In a certain species of plant loci A, B and C have an additive effect on the colour of the flower. Alleles A, B, and C are dominant and alleles a, b and c are recessive. Knowing that a plant with genotype AAbbCc has a pink flower, which genotype, among the ones listed below, will produce the same phenotype? Aabbcc. aabbcc. AaBbCc. AABBCc. In pea plants, tall (T) is dominant to dwarf (t) and yellow (Y) is dominant to green (y). In a cross of true-breeding tall yellow peas x dwarf green…arrow_forward
- From your knowledge about DNA microarray, answer the following: A- How DNA microarray is created? and why it is referred to as “hybridization technology”? B- Why RT-PCR is important in the sample preparation to perform expression microarray experiment? C- Mention the name and the color of the dyes used in expression microarray? D- If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?arrow_forwardNext-generation sequencing reveals that six new mutations have occurred in the coding regions of genes in an individual diploid fly. If the coding regions of this fly comprise 100 million nucleotides per haploid genome, what is the mutation rate per nucleotide?arrow_forwardWhat is the Central Dogma of Molecular Genetics? What impact did the discovery of RNA tumor viruses have on the central dogma?arrow_forward
- When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What are the controls you should use and why use these? What is special about the genomic DNA? What do you expect to find (using these genomic DNA samples)? please help!arrow_forwardSuppose a 10-year old patient has come to your office with a very rare disease. One so rare that only 100 people for the past 100 years have been diagnosed and nobody knows the gene or genes that are mutated in this disease. Describe the gene sequencing toold you would use to identify the mutated gene or genes in this hypothetical disease.arrow_forwardHere another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'arrow_forward
- What is the difference between nonhomologous end-joining (NHEJ) and homology-directed repair (HDR) in the context of genome editing?arrow_forwardThe genetic alteration responsible for sickle-cell anemia in humans involves: a transition mutation from A to G, substituting glutamic acid for valine in a-globin a transversion mutation from T to A, substituting valine for glutamic acid in b-globin a transition mutation from T to C, substituting valine for glutamic acid in b-globin a transversion mutation from G to C, substituting glutamic acid for valine in a-globin a frameshift mutation of one ATC codon, removing glutamic acid from b-globinarrow_forwarda. Describe two ways you could potentially make atransgene that would inhibit the function of a specific gene in a transgenic organism. (Hint: For oneof these techniques, recall the discussion of RNAinterference in Chapter 17.)b. Discuss how you could use either of these methodsto construct a mouse model for a recessive humangenetic condition associated with a loss of function, such as cystic fibrosis.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license