Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 26P
One problem that researchers sometimes encounter when editing genomes with CRISPR/Cas9 is that one or more loci other than the intended target can be recognized by Cas9/sgRNA and cleaved. Part of the reason is that single base pair mismatches between the target site and the sgRNA in the 5′-most half of the 20 bp DNA/RNA hybrid do not prevent Cas9 cleavage of the target site. How could scientists use bioinformatics to avoid such off-target effects?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following is a correct statement about CRISPR-Cas-9 gene editing?
Group of answer choices
A single guide RNA (sgRNA) recognizes a genomic region followed by 5'-NGG-3' PAM sequence
A single guide RNA (sgRNA) recognizes a genomic region followed by a long sequence palindrome repeat
A single guide DNA (sgDNA) recognizes a genomic region followed by 5'-NGG-3' PAM sequence
PAM sequences induce single stranded breaks that are then repaired by the CAS-9 enzyme
One problem that researchers sometimes encounterwhen editing genomes with CRISPR/Cas9 is that oneor more loci other than the intended target can berecognized by Cas9/sgRNA and cleaved. Part of thereason is that single base pair mismatches betweenthe target site and the sgRNA in the 5′-most half of the 20 bp DNA/RNA hybrid do not prevent Cas9cleavage of the target site. How could scientists usebioinformatics to avoid such off-target effects?
Why are restriction endonucleases considered a bacteria’s “innate immune system”?
Why is CRISPR-Cas9 considered a bacteria’s “adaptive immune system”?
What does CRISPR stand for?
What is the difference between crRNA and tracrRNA? Why are both needed for Cas9 to function?
What does PAM stand for? Where is it found?
What is the difference between Non-homologous End Joining (NHEJ) and Homology Directed Repair (HDR)?
What is the Guide RNA (gRNA) a chimera of? Why use a gRNA?
What new things are researchers doing with CRISPR-Cas9?
Reflecting on what you now know about CRISPR-Cas9, what are your thoughts on it’s use in humans and other organisms? What should we be allowed to do? Not do?
Are viruses living? Why or why not? What does obligate intracellular parasite mean?
What does every virus have? What is the difference between capsomers and…
Chapter 18 Solutions
Genetics: From Genes to Genomes
Ch. 18 - Match each of the terms in the left column to the...Ch. 18 - Mice are usually gray, but a mouse geneticist has...Ch. 18 - Sometimes, genes transferred into the mouse genome...Ch. 18 - In mice, a group of so-called Hox genes encode...Ch. 18 - The fly eyes shown in Fig. 18.7 are malformed...Ch. 18 - This problem concerns a technique called enhancer...Ch. 18 - Fish and other organisms that live in the Arctic...Ch. 18 - a. Describe two ways you could potentially make a...Ch. 18 - Figure 18.6 shows a picture of Glofish ,...Ch. 18 - Some people are concerned about the possible...
Ch. 18 - The goal of the Knockout Mouse Project is to...Ch. 18 - Prob. 12PCh. 18 - Prob. 13PCh. 18 - a. Which genome manipulation technique would you...Ch. 18 - a. Diagram a knockin construct that could have...Ch. 18 - Prob. 16PCh. 18 - Prob. 17PCh. 18 - The transcription factor Pax6 is required...Ch. 18 - Mouse models for human genetic diseases are...Ch. 18 - One way to determine where inside a cell a protein...Ch. 18 - In Problem 5 in Chapter 17, you saw that a SNP...Ch. 18 - Scientists now routinely use CRISPR/Cas9 to make...Ch. 18 - Geneticists are currently considering using...Ch. 18 - a. Figures 18.9 and 18.12 demonstrated methods to...Ch. 18 - Nonhomologous end-joining NHEJ of a double-strand...Ch. 18 - One problem that researchers sometimes encounter...Ch. 18 - Researchers at the University of California at San...Ch. 18 - Prob. 28PCh. 18 - F. Port and S. Bullock at the University of...Ch. 18 - On Fig 18.14, locate the PAM site and identify the...Ch. 18 - Prob. 31PCh. 18 - Prob. 32PCh. 18 - Recall that Leber congenital amaurosis LCA, a form...Ch. 18 - One potential strategy for gene therapy to correct...Ch. 18 - Recently, scientists have used a mouse model for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardWhat advantages do cDNA libraries provide over genomic DNA libraries? Describe cloning applications where the use of a genomic library is necessary to provide information that a cDNA library cannot.arrow_forwardIn order to target a specific region of genomic DNA with CRISPR, researchers must include a guide RNA containing a 20-basepair long spacer sequence that matches the DNA sequence at the target site. (i) How many possible guide RNA spacer sequences are there? (ii) One of the possible risks of genetic engineering methods is “off-target” editing, where a modification of the genome occurs in a part of the genome other than the target site. Imagine you design a 20-basepair guide RNA spacer sequence to target a specific portion of the Zebrafish genome, which is 1.7 billion nucleotides long. Assuming all nucleotides are equally common, estimate the probability that your spacer sequence occurs in at least one other position in the Zebrafish genome.arrow_forward
- In type II CRISPR-Cas9 systems, what intermediate interacts with the repeat sequences that are added to the guide RNA?arrow_forwardBelow is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.arrow_forwardWhy do geneticists studying eukaryotic organisms often construct cDNA libraries, whereas geneticistsstudying bacteria almost never do? Why might bacterial geneticists have difficulties constructing cDNA libraries even if they wanted to?arrow_forward
- Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?arrow_forwardWhat are the major components of the CRISPR-Cas9 system? What mechanism does it employ to combine DNA? Explain the process of how the CRISP-Cas9 system is able to create recombinant DNA. Relate the idea of gene modification to the fields of vaccines and applied microbiology as well.arrow_forwardWhy do researchers believe lncRNA is a promising field for developing drug therapies and CRISPR/Cas can be used to treat disease?arrow_forward
- Why did geneticists believe, even before direct experimental evidence was obtained, that the genetic code would turn out to be composed of triplet sequences and be nonoverlapping? Experimentally, how were these suppositions shown to be correct?arrow_forwardGene expression can be disrupted by techniques such as homologous recombination and RNA interference. What is the functional difference between these two methods in terms of the ultimate effect on gene expression? Why might homologous recombination or an alternative genome-editing method (e.g., CRISPR/Cas9) be preferred over RNA interference?arrow_forwardAfter Drosophila DNA has been treated with a restriction enzyme, the fragments are inserted into plasmids and selected as clones in E. coli. With the use of this “shotgun” technique, every DNA sequence of Drosophila in a library can be recovered.a. How would you identify a clone that contains DNA encoding the protein actin, whose amino acid sequence is known?b. How would you identify a clone encoding a specific tRNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
genetic recombination strategies of bacteria CONJUGATION, TRANSDUCTION AND TRANSFORMATION; Author: Scientist Cindy;https://www.youtube.com/watch?v=_Va8FZJEl9A;License: Standard youtube license