Biochemistry: Concepts and Connections Plus Mastering Chemistry with Pearson eText -- Access Card Package (2nd Edition) (What's New in Biochemistry)
2nd Edition
ISBN: 9780134804668
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 2, Problem 21P
Is RNA-binding enzyme RNase A more likely to have a pl of 9.2 or 5.0? Briefly explain your reasoning.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Give two reasons to explain why a proline residue in the middle of an αhelix is predicted to be destabilizing to the helical structure.
An enzyme consists of 1 polypeptide chain only and has a molecule weight of 30,000. Assuming the average wt. of an amino acid is 100, how many nucleotides are there in the gene controlling it?
Which regions of enzyme are most and least conserved among paralogs? Justify why you think this is the case (Limit 5-6 sentences)
Chapter 2 Solutions
Biochemistry: Concepts and Connections Plus Mastering Chemistry with Pearson eText -- Access Card Package (2nd Edition) (What's New in Biochemistry)
Ch. 2 - Suppose a chloride ion and a sodium ion are...Ch. 2 - Draw two different possible hydrogen-bonding...Ch. 2 - Prob. 3PCh. 2 - 4. What is the pH of each of the following...Ch. 2 - Prob. 5PCh. 2 - The weak acid HA is 2% ionized (dissociated) in a...Ch. 2 - 7. Calculate the pH values and draw the titration...Ch. 2 - What is the pH of the following buffer mixtures?...Ch. 2 - a. Suppose you wanted to make a buffer of exactly...Ch. 2 - Prob. 10P
Ch. 2 - You need to make a buffer whose pH is 7.0, and you...Ch. 2 - Describe the preparation of 2.00 L of 100 glycine...Ch. 2 - Carbon dioxide is dissolved in blood (pH 7.4) to...Ch. 2 - What is the molecular basis for the observation...Ch. 2 - The anno acid arginine ionizes according to the...Ch. 2 - It is possible to make a buffer that functions...Ch. 2 - A student is carrying out a biological preparation...Ch. 2 - Histidine is an amino acid with three titratable...Ch. 2 - Prob. 19PCh. 2 - A biochemical reaction takes place in a 1.00 ml...Ch. 2 - Is RNA-binding enzyme RNase A more likely to have...Ch. 2 - Consider a protein in which a negatively charged...Ch. 2 - Prob. 23PCh. 2 - Prob. 24P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- (A) Give the polypeptide translation of the RNA sequence below. 5’-AUGGAAAUCAAAGUCAACCUUGAGUUUAGA-3’ (B) Write the chemical structure of the polypeptide sequence you determined in part (a) (C) Given the chemical structure of the polypeptide sequence you have written in part (b), answer True or False for each of the 5 statements below. (1) At least one of the amino acids in the sequence can undergo phosphorylation (2) The sequence looks like it could form a β turn (3) The sequence looks like it could form a β strand with one surface facing the interior of the protein and the other surface exposed to water (4) At least one of the amino acids in the polypeptide sequence can undergo oxidation to form a disulfide bridge to another polypeptide (5) The sequence looks like it could form an α helix that would be part of a coiled coil structure within a proteinarrow_forwardAmino acids have an average molar mass of 100 g/mol.How many bases on a single strand of DNA are needed to codefor a protein with a molar mass of 5x10^5g/mol?arrow_forwardHere’s a Ramachandran plot. Give the dihedral angles--phi and psi--that are characteristic of a left handed helix.arrow_forward
- The primary amino acid sequence of a stretch of polypeptide is Asp-Glu-Pro-Lys-His-Arg. Would you expect this portion of the polypeptide to form an alpha helix at pH=5? Provide 3 reasons to justify your answer.arrow_forwardWhy is RNA polymerase a good name for this enzyme? Explain each part of the name: RNA, polymer and asearrow_forwardRNA nucleotides can undergo versatile base pairing. What does this mean, and what is the consequence for the structure of RNA? Please help simplify/explain this in 5 sentences or lessarrow_forward
- Which amino acid (also called amino acid residue)would be more likely to occur on the surface of a protein: an aspartate residue or a methionine residue? Explain your choice.arrow_forwardA mutation called base substitution mutation had been altered the sequence in a. eliminated the synthesis of all the polypeptide except one. The altered sequence is 5’ – AUGCAUACCUAUGUGACCCUUGGA – 3’. Use the genetic code table and determine why.arrow_forwardIn 1962, F. Chapeville and others reported an experiment in which they isolated radioactive 14C-cysteinyl-tRNACys (charged tRNACys + cysteine). They then removed the sulfur group from the cysteine, creating alanyl-tRNACys (charged tRNACys + alanine). When alanyl-tRNACys was added to a synthetic mRNA calling for cysteine, but not alanine, a polypeptide chain was synthesized containing alanine. What can you conclude from this experiment?arrow_forward
- A protein produced by bacteria is 300 amino acids long. Compute for the number of nucleotides in the section of DNA that code for this protein.arrow_forwardThe enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure of this modified nucleotide.arrow_forwardGiven the fragment Ala-Lys-Tyr-Gly-Phe and Leu-Val-Ser-His-Cys-Arg, what is the expected result in both fragments with CuSO4 and NaOH? a. dark violet solution b. light violet solution c. blue solution d. colorless solutionarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
Enzyme Kinetics; Author: MIT OpenCourseWare;https://www.youtube.com/watch?v=FXWZr3mscUo;License: Standard Youtube License