Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Question
Chapter 22, Problem 12EQ
Summary Introduction
To review:
The construction of a contig that will map the alignment of all the five given bacterial artificial chromosome (BAC) by using the data provided.
Introduction:
Sequence tagged sites (STS) are short segments of deoxyribonucleic acid (DNA)comprising of 200-500 base pairs, helping in sequence recognition in a genome. The sequence may contain overlapping clones called contigs. Contig maps are useful in studying a large segment of the genome containing an unbroken sequence of information due to overlapping.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
A purified recombinant protein is analyzed for molecular weight by SDS-PAGE at pH 8.5. From the protein sequence deduced from the gene that was expressed in bacteria, the protein is expected to have a molecular weight of 44,000. However, the molecular weight of the protein is found by SDS-PAGE to be 52,000. Explain the reason or reasons for this difference in molecular weight. What calculation could you make to help explain this discrepancy?
Using the Dynamic Programming algorithm for pairwise local alignment we covered in class, construct the dynamic programming score table for a local alignment of the following two sequences, using the following scoring parameters: match score = +5, mismatch score = -3, gap penalty = -2.: ACGTATCGCGTATA GATGCTCTCGGAAAWhat is score of the best local alignment between these two sequences? Show the alignment of these sequences.
asap
Describe the outcome of a chain-terminator sequencing procedure in which (a) too few primers are present or (b) an excess of primers is present.
Chapter 22 Solutions
Genetics: Analysis and Principles
Ch. 22.1 - Prob. 1COMQCh. 22.2 - Prob. 1COMQCh. 22.3 - A molecular marker is a _____ found at a specific...Ch. 22.3 - 2. Which of the following is an example of a...Ch. 22.3 - To map the distance between molecular markers via...Ch. 22.4 - 1. What is a contig?
a. A fragment of DNA that...Ch. 22.4 - A vector that can carry a large fragment of...Ch. 22.4 - 3. Chromosomal walking is a method of _____ in...Ch. 22.5 - Prob. 1COMQCh. 22.5 - Prob. 2COMQ
Ch. 22.5 - 3. A prokaryotic genome is about 4 million bp in...Ch. 22.6 - Metagenomics is aimed at a. determining the...Ch. 22 - 1. A person with a rare genetic disease has a...Ch. 22 - For each of the following, decide if it could be...Ch. 22 - Which of the following statements about molecular...Ch. 22 - 1. Is each of the following a method used in...Ch. 22 - Prob. 2EQCh. 22 - Prob. 3EQCh. 22 - The cells from a persons malignant tumor were...Ch. 22 - 5. Figure 23.2 describes the technique of FISH....Ch. 22 - Explain how DNA probes with different fluorescence...Ch. 22 - 7. A researcher is interested in a gene found on...Ch. 22 - Prob. 8EQCh. 22 - Prob. 9EQCh. 22 - Prob. 10EQCh. 22 - Prob. 11EQCh. 22 - Prob. 12EQCh. 22 - In the Human Genome Project, researchers have...Ch. 22 - 14. Take a look at question 3 in More Genetic...Ch. 22 - 15. Place the following stages of a physical...Ch. 22 - 16. What is an STS? How are STSs generated...Ch. 22 - 17. Four cosmid clones, which we will call cosmids...Ch. 22 - A human gene, which we will call geneX, is located...Ch. 22 - 19. Describe how you would clone a gene by...Ch. 22 - 20. A bacterium has a genome size of 4.4 Mb. If a...Ch. 22 - 21. Discuss the advantages of next-generation...Ch. 22 - Prob. 23EQCh. 22 - Prob. 24EQCh. 22 - Prob. 15EQCh. 22 - What is a molecular marker? Give two examples....Ch. 22 - Which goals of the Human Genome Project do you...
Knowledge Booster
Similar questions
- Below is an EMSA showing four different reactions, A-D. In each tube there is some combination of labelled DNA probe, Protein X (the protein you are studying), and an antibody for Protein X. Identify which combination of components are found in each of the four reactions and explain how you determined that based on the molecular interactions being studied and your knowledge of gel electrophoresis. It is possible that multiple lanes have the same component(s). A B C D EMSAarrow_forwardDescribe the outcome of a chain-terminator sequencing procedure in which (a) too little ddNTP is added or (b) too much ddNTP is added.arrow_forwardGenomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost. What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)? Probe 1 Probe 2 (a) 0.6kb 0.6kb and 1.2kb (b) 0.6kb and 1.8kb 0.6kb, 1.2kb and 1.8kb (c) 1.2kb 0.6kb (d) 1.8kb 1.8kb a. (a) b. (b) c. (c) d. (d)arrow_forward
- Below are 9 possible primer pairs. ● Determine which primer pair is the best choice by considering the following: 1. primers should be 18-24 bases in length; 2. base composition should be 45-55% (G+C); 3. primers should end (3') in a G or C, or CG or GC: this prevents "breathing" of ends and increases efficiency of priming; 4. Tms tween 55-70°℃ are preferred (Tas, annealing temperatures, are approximately 5°C lower than the Tm); 5. the Tm for your primer pair should be within 2 degrees of each other, though ideally the same; 6. runs of three or more Cs or Gs at the 3'-ends of primers may promote mispriming at G or C-rich sequences (because of stability of annealing), and should be avoided; 7. 3'-ends of primers should not be complementary (i.e. base pair), as otherwise the formation of primer dimers will result; 8. primer self-complementary (ability to form secondary structures such as hairpins) should be avoided. • Explain why the other primers are not good choices. ● Underline or…arrow_forwardA recombinant protein corresponding to 52 repeats of the peptide sequence YSPTSPS was covalently linked to agarose beads to make an affinity column. The beads were incubated with a nuclear extract and the protein:beads became phosphorylated. More nuclear extract was run over the column repeatedly and then the beads were washed extensively. The bound proteins were eluted from the column and when they were separated on a SDS-PAGE gel many bands appeared. What cellular process(es) might these proteins be involved in? Options: splicing polyadenylation DNA replication a and b only a, b and carrow_forwardIn a cotransformation experiment (see question 4 of More GeneticTIPS), DNA was isolated from a donor strain that was proA+ andstrC+ and sensitive to tetracycline. (The proA and strC genes conferthe ability to synthesize proline and confer streptomycin resistance,respectively.) A recipient strain is proA− and strC− and isresistant to tetracycline. After transformation, the bacteria werefirst streaked on a medium containing proline, streptomycin, andtetracycline. Colonies were then restreaked on a medium containingstreptomycin and tetracycline. (Note: Each type of medium hadcarbon and nitrogen sources for growth.) The following resultswere obtained:70 colonies grew on the medium containing proline, streptomycin,and tetracycline, but only 2 of these 70 colonies grew whenrestreaked on the medium containing streptomycin and tetracyclinebut lacking proline. If we assume the average size of the DNA fragments is 2 minutes,how far apart are these two genes?arrow_forward
- Following a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates (ddNTP's), separation of the primer reaction products was achieved using capillary gel electrophoresis. In the following example, ddATP was labeled with a 'green' fluorophore, ddTTP was labeled with 'red', ddCTP was labeled with 'black', and ddGTP was labeled with 'blue. From left to right (i.e., the shortest to longest retention time), the sequence was: AACGGTTGTCTCTGATTTGTATTATGTT. What is the sequence of the template DNA, from its 3' to 5' end? о ТTIGCCAACAGAGACTAAACATААТАСАА O TTGTATTATGTTTAGTCTCTGTTGGCAA О ААСАТААТАСАААТСAGAGAСAАССGTT O AACGGTTGTCTCTGATTTGTATTATGTTarrow_forwardCompute the percent identity of the following pairwise sequence alignment: -TGAGACTTAGAGT |..|... | | | | | ATAGGAGCGAGAGTarrow_forwardThe DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCGarrow_forward
- Calculate the dynamic programming matrix and the optimal local and global alignment for the DNA sequences a: GAATTC and b: GATTA, scoring +2 for a match, -1 for a mismatch, and using a linear gap penalty function WL) = -2L thank youarrow_forwardCompute the PERCENT IDENTITY for the following pairwise sequence alignment. ACTGATGGGGG--AGACGTA ||||| ... I ||||||| ACTG--AAAAGCTAGACGTAarrow_forwardUsing the formulae for dsDNA to calculate g/mol: You have a 4110 bp cloning vector Want to ligate a 245 bp insert for molecular cloning. efficient cloning requires that a 1:5 molar ratio of vector to insert is optimal for the ligation reaction. What are the relative weights of vector and the insert DNA necessary in g?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education