Genetics: Analysis and Principles
5th Edition
ISBN: 9780073525341
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 22, Problem 16EQ
Place the following stages of a physical mapping study in their most logical order:
A. Clone large fragments of DNA to make a BAC library.
B. Determine the DNA sequence of subclones from a cosmid library.
C. Subclone BAC fragments to make a cosmid library.
D. Subclone cosmid fragments for DNA sequencing.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following best describes the process of DNA seqencing.
a. DNA is seperated on a gel and the different bands are labled with flouroscent nucleotides and scanned with a laser.
b. A laser is used to flurorescently label the nucleotides present with in the DNA , the DNA is run on a gel and then the DNA is droken into fragments
c. Nucleotides are scanned with a laser and incrprorated into the DNA that has been seperated on a gel and then DNA is amplified with PCR.
d. fragments of DNA are produced in a reaction that lables them with any of four different fluroscent dyes and the fragmented then are run on a gel and scanned with laser
e. DNA is broken down into its constituents nucleotides and the nucleotides are then run on a gel and purified with a laser
a. What type of nucleic acid and from what species would the scientist use to begin
construction of her genomic DNA library?
b. From what tissue would she isolate this nucleic acid?
c. What type of reagent would the scientist use to cut the genome into appropriately sized
fragments?
d. What size nucleic acid fragments would one aim to prepare for the library construction
so as to to avoid having to screen an overwhelming number of clones?
e. Into what vector would the scientist ligate her genomic DNA fragments?
f. What organism would the scientist use to propagate the clones of her genomic DNA
library?
g. From the information given in the problem determine what probe could be used to
screen the scientist's library to find her clone of interest ?
Gel electrophoresis can be used to separate DNA on the basis of:
A.
the probe used.
B.
size.
C.
G and C nucleotide content.
D.
both size and loading buffer content.
E.
loading buffer content.
Chapter 22 Solutions
Genetics: Analysis and Principles
Ch. 22.1 - Prob. 1COMQCh. 22.2 - Prob. 1COMQCh. 22.3 - A molecular marker is a _____ found at a specific...Ch. 22.3 - 2. Which of the following is an example of a...Ch. 22.3 - To map the distance between molecular markers via...Ch. 22.4 - 1. What is a contig?
a. A fragment of DNA that...Ch. 22.4 - A vector that can carry a large fragment of...Ch. 22.4 - 3. Chromosomal walking is a method of _____ in...Ch. 22.5 - Prob. 1COMQCh. 22.5 - Prob. 2COMQ
Ch. 22.5 - 3. A prokaryotic genome is about 4 million bp in...Ch. 22.6 - Metagenomics is aimed at a. determining the...Ch. 22 - 1. A person with a rare genetic disease has a...Ch. 22 - For each of the following, decide if it could be...Ch. 22 - Which of the following statements about molecular...Ch. 22 - 1. Is each of the following a method used in...Ch. 22 - Prob. 2EQCh. 22 - Prob. 3EQCh. 22 - The cells from a persons malignant tumor were...Ch. 22 - 5. Figure 23.2 describes the technique of FISH....Ch. 22 - Explain how DNA probes with different fluorescence...Ch. 22 - 7. A researcher is interested in a gene found on...Ch. 22 - Prob. 8EQCh. 22 - Prob. 9EQCh. 22 - Prob. 10EQCh. 22 - Prob. 11EQCh. 22 - Prob. 12EQCh. 22 - In the Human Genome Project, researchers have...Ch. 22 - 14. Take a look at question 3 in More Genetic...Ch. 22 - 15. Place the following stages of a physical...Ch. 22 - 16. What is an STS? How are STSs generated...Ch. 22 - 17. Four cosmid clones, which we will call cosmids...Ch. 22 - A human gene, which we will call geneX, is located...Ch. 22 - 19. Describe how you would clone a gene by...Ch. 22 - 20. A bacterium has a genome size of 4.4 Mb. If a...Ch. 22 - 21. Discuss the advantages of next-generation...Ch. 22 - Prob. 23EQCh. 22 - Prob. 24EQCh. 22 - Prob. 15EQCh. 22 - What is a molecular marker? Give two examples....Ch. 22 - Which goals of the Human Genome Project do you...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- With regard to dideoxy sequencing, which of the following statementsis false?a. The dideoxy nucleotides are fluorescently labeled.b. The dideoxy nucleotides cannot be incorporated into a growingDNA strand.c. When incorporated into a DNA strand, the dideoxynucleotidesprevent further growth of the strand.d. The dideoxy sequencing method is used to determine the basesequence of DNA.e. The dideoxy sequencing method requires the use of primers.arrow_forwardTranscriptome analysis involves two separate methodologies: gene expression and RNA seq analyses. The 10 items below are a scrambled listing of the steps used in the two procedures. Identify the steps involved in RNA seq from the list below. Use the numbers in the list to refer to each step. Once the steps for RNA seq have been identified, write the steps in the order in which they are performed during the experiment. (1) DNA sequencing (2) Allow for hybridization and wash excess cRNA. (3) Mix labeled cRNA with array chip. (4) PCR amplification (5) Measure fluorescence intensity to determine abundance of transcripts. (6) Add labeled cRNA at each microarray location. (7) Map cDNA sequences to the genome of the organism to determine identity and abundance of transcripts. (8) mRNA isolation from cells (9) Prepare fluorescently labeled cRNA probes (10) cDNA synthesisarrow_forwardList essential components required for the DNA sequencing reaction based on the Sanger method. Briefly describe the purpose of each componentarrow_forward
- Consider the four extraction/purification methods . a. Which extraction method would you use for a touch DNA sample? Explain your reasoning.b. Which extraction method would you use for a sample containing a mixture of primarily non-human and some human DNA? INFO: the 4 extraction methods are QIAamp manual extraction, QIAcube semi-automated extraction, DNA IQ extraction, or FTA punch purificationarrow_forwardUse this information to match the list of probes to the 3 samples below: You have isolated several DNA sequences from a variety of mouse tissues. You have labeled each one of them with a radioisotope and will use them as probes on blots of several DNA and RNA somples. Below are a list of all the probes you generated (probes A through E) and a list of all the DNA and RNA samples that you will analyze (Samples 1 through 3) Beside each sample, write the letters corresponding to oll the probes that will bind to a complementary sequence in that sample. These responses are graded all or nothing! List of probes Probe A: promoter sequence of a gene that is only expressed in the nervous system Probe B: promoter sequence of one of the genes encoding a ubiquitously expressed histone protein Probe C: coding sequence of a gene that is only expressed in the nervous system Probe D: coding sequence of one of the genes encoding a ubiquitously expressed histone protein Probe E: intron of a gene that is…arrow_forwardDescribe the process for shotgun sequencing of a genome. Practice aligning the two sets of sequenced fragments below, to determine the order of the fragments and the complete sequence.arrow_forward
- With regard to DNA microarrays, answer the followingquestions:A. What is attached to the slide? Be specific about the numberof spots, the lengths of DNA fragments, and the origin ofthe DNA fragments.B. What is hybridized to the microarray?C. How is hybridization detected?arrow_forwardGive typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing are two different methods used to sequence DNA. Describe the general techniques of Maxim-Gilbert and Sanger DNA Sequencing. List the advantages and disadvantages of each.arrow_forwardExplain why DNA fragments migrate in a gel electrophoresis. Which fragments migrate farthest: large or small?arrow_forward
- Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGACarrow_forwardDiscuss at least three methods of DNA extraction and summarize each methods using a schematic diagram.arrow_forwardYou are asked to sequence a piece of DNA to determine if it is from a gene thought to be involved in the development of breast cancer. The sequence of the template strand is ATGCCCGTAATCGTTA and you are given the primer TAACGA. You take these along with a sequencing kit that contains everything else needed for sequencing. You then run the sequencing experiment and analyze the results on a sequencing gel. Which of the following gels (A-D) is the correct sequencing gel for this experiment? Answers: A-D A A BB CC DD Question #3 attachment A ATOC B с A TO C ATOC ATOCarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License