Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 22, Problem 2NST
Summary Introduction
To determine: The sequence of the probe that will hybridize the ASO sequence.
Introduction: Allele-specific oligonucleotide (ASO) is a short synthetic DNA which is complementary to the sequence of target DNA. ASO analysis is done under conditions that facilitate only complementary
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
The DNA sequence of one strand of a gene from threeindependently isolated mutants is given here (5′ endsare at left). Using this information, what is the sequence of the wild-type gene in this region?mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCGmutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCGmutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG
The genetic alteration responsible for sickle-cell anemia in humans involves:
a transition mutation from A to G, substituting glutamic acid for valine in a-globin
a transversion mutation from T to A, substituting valine for glutamic acid in b-globin
a transition mutation from T to C, substituting valine for glutamic acid in b-globin
a transversion mutation from G to C, substituting glutamic acid for valine in a-globin
a frameshift mutation of one ATC codon, removing glutamic acid from b-globin
Chapter 22 Solutions
Concepts of Genetics (12th Edition)
Ch. 22 - In order to vaccinate people against diseases by...Ch. 22 - Prob. 2NSTCh. 22 - Prob. 1CSCh. 22 - Prob. 2CSCh. 22 - Prob. 3CSCh. 22 - HOW DO WE KNOW? In this chapter, we focused on a...Ch. 22 - Prob. 2PDQCh. 22 - Why are most recombinant human proteins produced...Ch. 22 - One of the major causes of sickness, death, and...Ch. 22 - Sequencing the human genome, the development of...
Ch. 22 - Prob. 6PDQCh. 22 - As genetic testing becomes widespread, medical...Ch. 22 - Prob. 8PDQCh. 22 - Prob. 9PDQCh. 22 - Does genetic analysis by ASO testing allow for...Ch. 22 - Maternal blood tests for three pregnant women...Ch. 22 - What is the main purpose of genome-wide...Ch. 22 - Describe how the team from the J. Craig Venter...Ch. 22 - Prob. 14PDQCh. 22 - Prob. 15PDQCh. 22 - Dominant mutations can be categorized according to...Ch. 22 - In 2013 the actress Angelina Jolie elected to have...Ch. 22 - Prob. 18PDQCh. 22 - Should the FDA regulate direct-to-consumer genetic...Ch. 22 - Prob. 20ESPCh. 22 - Following the tragic shooting of 20 children at a...Ch. 22 - Private companies are offering personal DNA...Ch. 22 - Prob. 23ESPCh. 22 - Prob. 24ESPCh. 22 - Prob. 25ESPCh. 22 - Craig Venter and others have constructed synthetic...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides? What are the codons in the translated portion of the mRNA transcribed from the normal and mutant genes? What type of mutation is present in the mutant hemoglobin gene?arrow_forwardYou have discovered a family with a new genetic form of anemia. The DNA sequences at the 5’ end of the non-template strand of the normal and mutant DNA encoding the alpha subunit of hemoglobin are given below: Normal 5’-ACGTTATGCCGTACTGCCAGCTAACTGCTAAAGAACAATTA…..-3’ Mutant 5’-ACGTTATGCCCGTACTGCCAGCTAACTGCTAAAGAACAATTA….-3’ What are the amino acid sequences of the normal and mutantpolypeptides?arrow_forwardThe most common MCAD mutation is shown below. The coding strand is shown for both the WT and mutant. The TATA box and kozak sequences are in parenthesis. What type of mutation is present? Wild-type:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ Mutant:5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGC AGAGCATACTGAGGGTAGTAG-3’ Answer: Is this a transition mutation? because there is an exchange of G instead of A? It kind of confuses me a little. helparrow_forward
- Based on the following wild type DNA sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table and remember you have been given DNA sequence). Wild Type: 5’ ATG GCT AGA GTC GAG TTG 3’ Mutant 1: 5’ ATG GCA GAG TCG AGT TG 3’ Mutant 2: 5’ ATG GCT TGA GTC GAG TTG 3’ Mutant 3: 5’ ATG GCT AGA GTT GAG TTG 3’ Mutant 4: 5’ ATG GCT AGA AGT CGA GTT G 3’ Mutant 5: 5’ ATG GCT AGA ATC GAG GTT 3’arrow_forwardIdentify the type of point mutation on the following strands (transition or transversion): a. 5’ TACTGCA 3’ 5’ TATTGCA 3’ 3’ ATGACGT 5’ 3’ ATAACGT 5’ b. 5’ CGACGTTA 3’ 5’ CGAGGTTA 3’ 3’ GCTGCAAT 5’ 3’ GCTCCAAT 5’c. Which of these types is more common and why?arrow_forwardBased on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGGarrow_forward
- he Sequence below comes from the alpha-2 globin of the human hemoglobin gene cluster found in chromosome 16. The globin region of the hemoglobin protein itself consists of 2 alpha chains and 2 beta chains. 1 actcttctgg tccccacaga ctcagagaga acccaccatg gtgctgtctc ctgccgacaa 61 gaccaacgtc aaggccgcct ggggtaaggt cggcgcgcac gctggcgagt atggtgcgga 121 ggccctggag aggatgttcc tgtccttccc caccaccaag acctacttcc cgcacttcga 181 cctgagccac ggctctgccc aggttaaggg ccacggcaag aaggtggccg acgcgctgac 241 caacgccgtg gcgcacgtgg acgacatgcc caacgcgctg tccgccctga gcgacctgca 301 cgcgcacaag cttcgggtgg acccggtcaa cttcaagctc ctaagccact gcctgctggt 361 gaccctggcc gcccacctcc ccgccgagtt cacccctgcg gtgcacgcct ccctggacaa 421 gttcctggct tctgtgagca ccgtgctgac ctccaaatac cgttaagctg gagcctcggt 481 agccgttcct cctgcccgct gggcctccca acgggccctc ctcccctcct tgcaccggcc 541 cttcctggtc…arrow_forwardUtilizing Hind III and EcoR V Restriction Enzyme with Pet41 and the following gene of interest... a tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg tatgccaatg aactgcaatt ggacggtttc 781…arrow_forwardA 210-bp sequence within the CFTR gene on human chromosome 7 is shown below. The three bold underlined nucleotides are deleted in a common cystic fibrosis (CF) mutation, removing a phenylalanine amino acid from the CFTR protein. 1 AGAGGGTAAA ATTAAGCACA GTGGAAGAAT TTCATTCTGT TCTCAGTTTT 51 CCTGGATTAT GCCTGGCACC ATTAAAGAAA ATATCATCTT TGGTGTTTCC 101 TATGATGAAT ATAGATACAG AAGCGTCATC AAAGCATGCC AACTAGAAGA 151 GGTAAGAAAC TATGTGAAAA CTTTTTGATT ATGCATATGA ACCCTTCACA 201 CTACCCAAAT PCR primers have been designed to amplify fragments within this sequence: Forward: GGATTATGCCTGGCACCATT Reverse: AGTGTGAAGGGTTCATATGC DNA from a CF patient is tested with a PCR assay using a pair of these primers, and the PCR product is found to be 3 bp shorter than that expected from the sequence shown above. What length PCR products (in bp) would you expect in the mother of the CF patient? A. 95 and 92 B. 149 C. 133 and 130 D. 149 and 146 E. 146arrow_forward
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-arrow_forwardA research group is studying a bacterium X that binds to mucosal cells in the lung and invades. Wildtype X has an LD50 value of 10 bacteria when administered to mice by inhalation. Using transposon mutagenesis, the researchers have isolated two mutants of X that they call Xmut1 and Xmut2, both of which have LD50 values of 105 when inhaled by mice. However, in tissue culture cells, Xmut1 can invade the cells just as well as wild-type X, while Xmut2 cannot. Provide a possible explanation for these results.arrow_forwardMutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids). (a) Nonsense mutation in a coding region (b) Insertion in Exon 1, causing frameshift (c) Insertion in Exon 7, causing frameshift (d) Missense mutation (e) Deletion in Exon 2, causing frameshift (f) Deletion in Exon 2, in frame (g) Large deletion covering Exons 2 and 3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY