Genetics: Analysis and Principles
6th Edition
ISBN: 9781259616020
Author: Robert J. Brooker Professor Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 23, Problem 20EQ
A bacterium has a genome size of 4.4 Mb. If a researcher carries out shotgun DNA sequencing and sequences a total of 19 Mb, what is the probability that a base will be left unsequenced? What percentage of the total genome will be left unsequenced?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A bacterium has a genome size of 4.4 Mb. If a researchercarries out shotgun DNA sequencing and sequences a totalof 19 Mb, what is the probability that a base will be leftunsequenced? What percentage of the total genome will beleft unsequenced?
Which DNA fragment will be closest to the top (negative pole) of anelectrophoretic gel?a. 450 bp
b. 3,560 bp
c. 5 kb
d. 1,500 bp
Approximately how large is the Escherichia coli genome in basepairs? How many genes does it contain?
Chapter 23 Solutions
Genetics: Analysis and Principles
Ch. 23.1 - Prob. 1COMQCh. 23.2 - Prob. 1COMQCh. 23.3 - A molecular marker is a _____ found at a specific...Ch. 23.3 - 2. Which of the following is an example of a...Ch. 23.3 - To map the distance between molecular markers via...Ch. 23.4 - 1. What is a contig?
a. A fragment of DNA that...Ch. 23.4 - A vector that can carry a large fragment of...Ch. 23.4 - 3. Chromosomal walking is a method of _____ in...Ch. 23.5 - Prob. 1COMQCh. 23.5 - Prob. 2COMQ
Ch. 23.5 - 3. A prokaryotic genome is about 4 million bp in...Ch. 23.6 - Metagenomics is aimed at a. determining the...Ch. 23 - 1. A person with a rare genetic disease has a...Ch. 23 - For each of the following, decide if it could be...Ch. 23 - Which of the following statements about molecular...Ch. 23 - 1. Is each of the following a method used in...Ch. 23 - Prob. 2EQCh. 23 - Prob. 3EQCh. 23 - The cells from a persons malignant tumor were...Ch. 23 - 5. Figure 23.2 describes the technique of FISH....Ch. 23 - Explain how DNA probes with different fluorescence...Ch. 23 - 7. A researcher is interested in a gene found on...Ch. 23 - Prob. 8EQCh. 23 - Prob. 9EQCh. 23 - Prob. 10EQCh. 23 - Prob. 11EQCh. 23 - Prob. 12EQCh. 23 - In the Human Genome Project, researchers have...Ch. 23 - 14. Take a look at question 3 in More Genetic...Ch. 23 - 15. Place the following stages of a physical...Ch. 23 - 16. What is an STS? How are STSs generated...Ch. 23 - 17. Four cosmid clones, which we will call cosmids...Ch. 23 - A human gene, which we will call geneX, is located...Ch. 23 - 19. Describe how you would clone a gene by...Ch. 23 - 20. A bacterium has a genome size of 4.4 Mb. If a...Ch. 23 - 21. Discuss the advantages of next-generation...Ch. 23 - Prob. 22EQCh. 23 - Prob. 23EQCh. 23 - What is a molecular marker? Give two examples....Ch. 23 - Which goals of the Human Genome Project do you...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- What are the benefits of using a mixture classification scheme as outlined in DNA Box 14.1? What would be the advantages of using software for deciphering mixture components?arrow_forwardWhich vectors (plasmid, phage λ, cosmid, bacterial artificial chromosome) can be used to clone a continuous fragment of DNA with the following lengths? a. 4 kb b. 20 kb c. 35 kb d. 100 kbarrow_forwardHow many Illumina clusters would you need to generate 15X coverage of the human genome, assuming your read lenght is 600 bp? (assume a human genome size of 3 billion bp) - 2.5 billion - 75 million - 7 million - 100 millionarrow_forward
- How would I calculate sanger sequencing fragments that will produce greenarrow_forwardDefine the following terms: Genome Bacteriophage λ DNAarrow_forwardWhat is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if it was formed using the following template DNA segments? 3′ AATGC 5′ 5′ AATGC 3′ 3′ GCAGC 5′ 5′ GCAGC 3′arrow_forward
- The following gel was produced in manual DNA sequencing. What would the unknown DNA template be that this gel represents?arrow_forwardWhat are the two advantages of using sequence analysis of ribosomal components in determining the relatedness of organisms? please explain why each is an advantage.arrow_forwardIn a transformation experiment, donor DNA was obtained from aprototroph bacterial strain (a+b+c+), and the recipient was a tripleauxotroph (a-b-c-). What general conclusions can you draw aboutthe linkage relationships among the three genes from the followingtransformant classes that were recovered? a+ b- c- 180 a- b+ c- 150 a+ b+ c- 210 a- b- c+ 179 a+ b- c+ 2 a- b+ c+ 1 a+ b+ c+ 3arrow_forward
- Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'arrow_forwardConvert each of the following 3′-to-5′ DNA base sequences to 5′-to-3′ DNA base sequences. a. 3′ ATCG 5′ b. 3′ AATA 5′ c. 3′ CACA 5′ d. 3′ CAAC 5′arrow_forwardThe diagram shows an autoradiograph of a DNA sequencing gel. What is the 5' to 3' sequence of the template strand ("inferred strand") based on the pattern in this gel?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License