EBK LIFE: THE SCIENCE OF BIOLOGY
11th Edition
ISBN: 8220103935432
Author: Sadava
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 23.1, Problem 2R
Summary Introduction
To review:
A simple count of the
Given:
Sequence a: AATGCAGGGTATACG
Sequence b: ATTCAGGGTATACC
Introduction:
An ancestral sequence can undergo multiple changes over the time to give rise to the divergent sequences. These changes include insertions, deletions, and single-base substitutions. The differences or divergence between the two sequences may be analyzed by a simple alignment of the sequences.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Design a pair of primers to amplify the entire length of the following 45 base pair sequence.Make each primer 14 bases long. Write the sequences of the primers in 5' to 3' order.(Hint: It will help for you to write out BOTH strands of the DNA sequence listed below.5'-GATGCCCGTTGGATAAATTGGGCGTCTAGAATCGGTCACACTTAG-3'
The relative proportions of cytosine-guanine and adeninethymine bonds in a DNA sample can be estimated by measuring its “melting temperature,” the temperature at which half of the DNA strands have pulled apart. Samples with a high percentage of cytosine-guanine pairs have a higher melting temperature than samples with a high percentage of adeninethymine pairs. Explain why this is so, considering the nature of the bonds that hold the base pairs together (look back at as shown).
Given the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?
Chapter 23 Solutions
EBK LIFE: THE SCIENCE OF BIOLOGY
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleoside triphosphate—say, ddCTP—is added to the sequencing reaction along with a larger amount of the corresponding dCTP. What resultwould be observed if the dCTP were omitted?arrow_forwardSuppose that a nearly perfect 20- basepair inverted repeat is observed in a DNA sequence. Provide two possible explanations.arrow_forwardWhat does the symbol “N” indicate (see the arrow)? Is this a problem for getting an accurate DNA sequence? The height of the peak in the figure is an indication of the quality of the data, with a high peak correlated with a low error in “base-calling” of perhaps 1 error in 10,000 bases. Is this generally a high-quality DNA sequence for determining the true DNA sequence of the gene studied? How can you tell? Which end of the sequence shown above is the 5’ end of the sequence being made via PCR.arrow_forward
- Assume that an error is made: adenine and guanine are matched as base pairs. What would be the impact on the structure of DNA? What would be the structural impact if adenine and cytosine were paired?arrow_forwardGive only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'arrow_forwardThe temperature at which a DNA sample denatures can be used to estimate the proportion of its nucleotide pairsthat are G- C. What would be the basis for this determination, and what would a high denaturation temperature for aDNA sample indicate?arrow_forward
- Ethanol (CH3-CH2-OH) is miscible in water because it is able to form hydrogen bonds with itself and other molecules. However, its structure only allows it to form 1-2 hydrogen bonds. This is one reason why even low concentrations of ethanol in solution are lethal for cells. Based on this information, explain why we can use high concentrations of ethanol to precipitate DNA out of solution. Also, describe/predict the effects of increasing concentrations of ethanol in (and around) a cell on macro-molecular interactions (i.e. on weak bonds). Finally, it is possible to select for yeast that are tolerant to increased concentrations of ethanol. Give an example of a physiological change in yeast cells that might make them resistant to ethanol.arrow_forwardUsing the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) Barrow_forwardGive typing answer with explanation and conclusion to all parts Maxim-Gilbert and Sanger Sequencing are two different methods used to sequence DNA. Describe the general techniques of Maxim-Gilbert and Sanger DNA Sequencing. List the advantages and disadvantages of each.arrow_forward
- based on the picture What is the length in basepairs of these sequences? How many base substitutions are there between these sequences? Count ONLY the instances where there is ANY nucleotide difference between any of the sequences (leave out any indels in this count) Are there any indels in this alignment? (yes or no)arrow_forwardSuppose you are comparing two sequences that are 100 bases long. To calculate the percent similarity (also referred to as percent identity) between the two sequences, you simply count the total number of bases that are identical between the two sequences and divide that value by 100. For example, if two sequences that are 100 bases long have 80 80 bases in common, the percent similarity would be 80% ( 100 x 100). Now practice with three shorter sequences. The following sequences are from three related organisms: Organism A: TGGCATTCAT Organism B: TCGAATACGA Organism C: TGCCTTACAT Drag the terms on the left to the appropriate blanks on the right to answer the questions. Not all terms will be used. Reset Help 30% What is the percent similarity between organisms A and B? 40% What is the percent similarity between organisms A and C?arrow_forwardAilee is interested to determine the nucleotide sequence of her bacterial heat shock gene. Hence, DNA sequencing needs to be performed for this analysis. One of the earliest methods invented is known as Sanger sequencing. Explain in detail the mechanism of this sequencing technique with the aid of a simple diagram.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License