BIO 1406/07 W/CONNECT/LM NEW >IC<
16th Edition
ISBN: 9781260075762
Author: Raven
Publisher: MCG CUSTOM
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 25, Problem 4U
Hox genes are
a. found in both plants and animals.
b. found only in animals.
c. found only in plants.
d. only associated with genes in the MADS complex.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
1a) Why is it possible for you to study the eye colour gene by extracting cheek cells?
a. Because the nucleus of every cell in the human body contains the same genetic information.
b. Because the cheek cells are located near the cells of the eye and so they are able to exchange DNA.
c. Because all genes in the human body are expressed at all times so it is easy to study them.
d. All of the above are possible explanations.
1b) What is the purpose of heating the sample to 75°C following addition of the 0.2M NaOH solution?
a. To denature the histone proteins that are keeping the DNA tightly coiled.
b. To ensure that all the DNA is removed from the swab in preparation for PCR.
c. To breakdown the cheek cell membrane to release the DNA from the cell.
d. It breaks down the circular DNA down into linear fragments so that they will be easier to visualize.i
Which of the following statements about the differential expression of human genes is correct?
A. Differential expression does not occur during embryogenesis (development of the embryo).
B. The unused genes in differentiated cells no longer retain the potential to be expressed.
C. Gene expression patterns of all cells are identical.
D. Every cell nucleus contains the complete genome established in the fertilized egg.
At birth a child has got blue eyes, but now his/her eyes turn brown. Which of the following statements would best explain the observed phenomena?
A. The child does not have brown pigment at birth
B. Eye’s colour at birth is affected by mother’s gene
C. Gene repressor for brown pigment produced is not yet active
D. Gene activatior for brown pigment production is not yet active at birth
E. All of the above statements are false
Chapter 25 Solutions
BIO 1406/07 W/CONNECT/LM NEW >IC<
Ch. 25 - Heterochrony is a. the alteration of the spatial...Ch. 25 - Vast differences in the phenotypes of organisms as...Ch. 25 - Homoplastic structures a can Involve convergence...Ch. 25 - Hox genes are a. found in both plants and animals....Ch. 25 - The Brachyury and Thx5 in vertebrates and the Ap3...Ch. 25 - Which of the following statements about Pax6 is...Ch. 25 - Which of the following statements about TbxS is...Ch. 25 - Prob. 8UCh. 25 - Transcription factors are a. genes. b. sequences...Ch. 25 - Independently derived mutations of the CTC gene in...
Ch. 25 - Prob. 1ACh. 25 - Prob. 2ACh. 25 - The Eda allele that causes reduced armor...Ch. 25 - Prob. 4ACh. 25 - The paired-like homeodomain transcription factor 1...Ch. 25 - From the chapter on evolution of development it...Ch. 25 - Phenotypic diversity among major groups of...Ch. 25 - Critique the argument that eyes have multiple...Ch. 25 - Prob. 5SCh. 25 - Having read all of this chapter return to the clam...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Insect wings are coded for by the same gene that creates... A. internal air branches (trachea) B. Their cuticle C. their antennae D. parts of crustacean appendages, like legsarrow_forwardWhich of the following BEST states genome editing in plants? A. transform large DNA constructs by suppression and activation B. insert a functional cis-regulatory element in the natural genes transgene vector C. assemble and synthesize large DNA molecules in a single transgene vector D. deletion, mutation, or integration of the gene of interest depending on the target traitarrow_forwardenb Which of the following was the mutation observed in the golb13 mutant line of zebrafish: A. A frameshift mutation B. A missense mutation C. A nonsense mutation D. A chromosomal deletion E. A gene switch mutationarrow_forward
- In comparison to experimental results from the genetic manipulation of an invertebrate model, what pathologic outcome(s) would suggest that multiple homologs of a disease gene are present in humans? a. Missing the essential gene homolog that is lethal in fruit flies is also lethal in human infants. b. Different homologs of the essential gene are each expressed in different human organs, and mutations in these duplicated genes cause organ-specific diseases. c. Different homologs of the essential gene are each expressed in different stages of early child development, and mutations in each of these duplicated genes cause different diseases. d. In humans, defects in different homologs of the essential gene cause different loss-of-function diseases due to subfunctionalization. e. The essential gene is lethal in fruit flies, but there is no disease phenotype exhibited in people.arrow_forwardYou are studying Hox genes in crane flies (Leptotarsus testaceus). The cranefly genome is sequenced, and in craneflies. Using your understanding of Hox genes, design an experiment testing where the homolog of the EVE gene is expressed in cranefly embryos. you have access to this sequence. You are interested in studying the EVE genearrow_forwardfill in the blank: a. lincRNA plays a role in regulating ___ making genes but they themselves are encoded in the genome that is considered _____ DNA. b. The most well known example of RNA regulating the expression of DNA is the production of the ___ that coats one copy of the X chromosome in a female forming the ____.arrow_forward
- Which of the following statement(s) is/are true with regard to positional information in Drosophila? A. Morphogens are a type of molecule that conveys positional information. B. Morphogenetic gradients are established only in the oocyte, prior to fertilization. C. Cell adhesion molecules also provide a way for a cell to obtain positional information.arrow_forwardDevelopmental genes are often highly conserved. However, organisms with very similar genes can appear quite different. How is this possible? A. The genes may usually undergo mutation during development, resulting in the production of varied proteins in individual cells. B. If an identical gene is turned on at different stages in development, it can have very different effects. C. Even if genes are quite similar, they always produce proteins with different functions. D. If the genes are very similar, they must always be expressed similarly (at similar times in development) but may sometimes still have varying effects.arrow_forwardBefore Muller's discovery that radiation induces mutation, scientists had to work on spontaneous mutants that were found solely by phenotype differences in natural populations. Which of the features of Drosophila made it a fortuitous choice for Morgan and his colleagues? a. large number of visible phenotypes b. especially high rate of mutation c. both sexual and asexual reproduction d. having a long life cycle e. well-known biochemical pathwaysarrow_forward
- A single zebrafish gene function was inactivated completely by mutation, and a zebrafish with this mutation had none of its normal horizontal stripes. Foreach of the following statements, indicate whether the statement is certainly true, certainly untrue, or if thereis insufficient information to decide.a. The normal gene function is required for the viability of the zebrafish.b. The normal gene function is required for the formation of stripes.c. The normal gene function is required to make thepigment deposited in the stripes.d. The gene is required in zebrafish only for stripeformation.arrow_forwardOf those in the following list, which organ(s)/tissue(s) is/are affected by mutations in this gene CAGATTGTGAAGAGGTCTCTTGA? select all that apply a. pancreas b. skin c. heart d. eyes e. spine and skeleton f. colonarrow_forwardResearchers studying the Dutch famine of the winter of 1944-45 found that effects of malnutrition during pregnancy were still seen two generations later, for example in rates of obesity. How could this environmental effect be inherited over generations? Choose the most likely answer A. The results were an artefact, because environmental conditions were not taken into account. B. Histone modifications such as acetylation are passed on through generations. C. All methylation patterns are scrubbed during development of an embryo. D. DNA methylation patterns can be passed on in a parent-of-origin specific manner.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mechanisms of Genetic Change or Evolution; Author: Scientist Cindy;https://www.youtube.com/watch?v=5FE8WvGzS4Q;License: Standard Youtube License