Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)
8th Edition
ISBN: 9780135213759
Author: John McMurry, David Ballantine
Publisher: PEARSON+
bartleby

Videos

Question
Book Icon
Chapter 26, Problem 26.23UKC
Interpretation Introduction

Interpretation:

The hydrogen bonding exists in structure and the sequence of each strand of DNA has to be predicted.

Concept Introduction:

Composition of nucleic acid: Nucleic acid is a polymer of nucleotides. Each nucleotide has three parts: a sugar, a nitrogenous base, and a phosphate group. Two nucleotides are joined by phosphate diester linkage where a free phosphate on 5’ carbon of one nucleotide and a free –OH group on 3’ carbon of another nucleotide.

Base pairing in DNA: The two strands of the DNA double helix run in the opposite directions- one in 5’ to 3’ direction and other from 3’ to 5’ direction. The hydrogen bonding between two strands enhances the stability of the DNA; where the alignment of hydrophobic nitrogenous bases in the interior and hydrophilic phosphate and sugar groups on the exterior also enhance the stability. Adenine and thymine gives a pair forming two hydrogen bonds and cytosine and guanine gives rise to another pair forming three hydrogen bonds.

Sugar: In both DNA and RNA, sugar portion is found. In DNA, the sugar is D-ribose, where at 2’hydroxyl group is absent and in RNA, the hydroxyl group is present at 2’.

Nucleotide: (Nucleoside + phosphate)

Nucleotides are the building blocks of nuclei acids; monomers of DNA and RNA polymers. At carbon-5’ of the ribose sugar, a phosphate group is added which is collectively known as nucleotide. Phosphate groups can be added to any of the nucleotide to form diphosphate or triphosphate.

Nitrogenous bases: Five types of nitrogenous bases (has unique one-letter code A, G, T, U, and C) are derived from two parent compounds called purine and pyrimidine. The purine derivatives are Adenine and Guanine are two fused nitrogen containing rings. The pyrimidine derivatives are Thymine, Cytosine, and Uracil has a six-membered nitrogen  ring.  Adenine, Guanine, Thymine, and Cytosine are the nitrogenous bases present in DNA. Adenine, Guanine, Cytosine and Uracil are the nitrogenous bases present in RNA.

Numbering the atoms in sugar and base rings:

Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+), Chapter 26, Problem 26.23UKC

In order to distinguish the atoms in the sugar of a nucleoside and atoms of a base ring, numbers without prime is used for atoms in the base ring and numbers with prime used for the atoms in the sugar ring.

Blurred answer
Students have asked these similar questions
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
Write the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACAT
draw a strand of DNA 4 nucleotides long (4 nucleotides on each side). Label the 5’ ends, the 3’ ends, the bond that holds the DNA backbone together, the glycosyl bond, and the bond that holds the nitrogenous bases together. You can use “P” to represent phosphate, and ATCG to represent the nitrogenous bases. Please try to draw the sugar accurately and include any unbonded functional groups, including the oxygen within the molecule.

Chapter 26 Solutions

Pearson eText Fundamentals of General, Organic, and Biological Chemistry -- Instant Access (Pearson+)

Ch. 26.4 - Prob. 26.11KCPCh. 26.6 - What are Okazaki fragments? What role do they...Ch. 26.6 - Prob. 26.13PCh. 26.8 - Prob. 26.14PCh. 26.8 - Prob. 26.15PCh. 26.9 - Prob. 26.1CIAPCh. 26.9 - Prob. 26.2CIAPCh. 26.9 - Using a variety of sources, research which...Ch. 26.9 - Prob. 26.4CIAPCh. 26.9 - List possible codon sequences for the following...Ch. 26.9 - Prob. 26.17PCh. 26.9 - What amino acids do the following sequences code...Ch. 26.9 - Prob. 26.19PCh. 26.10 - Prob. 26.20PCh. 26.10 - What anticodon sequences of tRNAs match the mRNA...Ch. 26 - Combine the following structures to create a...Ch. 26 - Prob. 26.23UKCCh. 26 - Copy the following simplified drawing of a DNA...Ch. 26 - Prob. 26.25UKCCh. 26 - Prob. 26.26UKCCh. 26 - Prob. 26.27APCh. 26 - Prob. 26.28APCh. 26 - Prob. 26.29APCh. 26 - Prob. 26.30APCh. 26 - Prob. 26.31APCh. 26 - For the following molecule: (a) Label the three...Ch. 26 - Prob. 26.33APCh. 26 - Prob. 26.34APCh. 26 - Prob. 26.35APCh. 26 - Prob. 26.36APCh. 26 - Draw structures to show how the sugar and...Ch. 26 - What is the difference between the 3 end and the 5...Ch. 26 - Prob. 26.39APCh. 26 - Prob. 26.40APCh. 26 - Draw the complete structure of the RNA...Ch. 26 - Prob. 26.42APCh. 26 - Prob. 26.43APCh. 26 - Prob. 26.44APCh. 26 - Prob. 26.45APCh. 26 - If a double-stranded DNA molecule is 22% G, what...Ch. 26 - How are replication, transcription, and...Ch. 26 - Why is more than one replication fork needed when...Ch. 26 - Prob. 26.49APCh. 26 - What are the three main kinds of RNA, and what are...Ch. 26 - Prob. 26.51APCh. 26 - Prob. 26.52APCh. 26 - Prob. 26.53APCh. 26 - Prob. 26.54APCh. 26 - What is a codon and on what kind of nucleic acid...Ch. 26 - Prob. 26.56APCh. 26 - Prob. 26.57APCh. 26 - Prob. 26.58APCh. 26 - What amino acids are specified by the following...Ch. 26 - Prob. 26.60APCh. 26 - What anticodon sequences are complementary to the...Ch. 26 - Prob. 26.62APCh. 26 - Refer to Problem 26.62. What sequence appears on...Ch. 26 - Refer to Problems 26.62 and 26.63. What dipeptide...Ch. 26 - Prob. 26.65APCh. 26 - Prob. 26.66APCh. 26 - Prob. 26.67APCh. 26 - Prob. 26.68APCh. 26 - Prob. 26.69APCh. 26 - Prob. 26.70CPCh. 26 - Prob. 26.71CPCh. 26 - Prob. 26.73CPCh. 26 - Prob. 26.75GPCh. 26 - Prob. 26.76GPCh. 26 - Prob. 26.77GPCh. 26 - Prob. 26.78GP
Knowledge Booster
Background pattern image
Biochemistry
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA Use In Forensic Science; Author: DeBacco University;https://www.youtube.com/watch?v=2YIG3lUP-74;License: Standard YouTube License, CC-BY
Analysing forensic evidence | The Laboratory; Author: Wellcome Collection;https://www.youtube.com/watch?v=68Y-OamcTJ8;License: Standard YouTube License, CC-BY