For the synthesis of metenkephalin, the mRNA sequence has to be synthesized. Concept Introduction: Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three- nucleotide sequence that is a stop codon and stops translation. Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis. Illustrated relationships are: DNA informational strand : 5’ ATG CCA GTA GGC CAC TTG TCA 3’ DNA Template strand : 3’ TAC GGT CAT CCG GTG AAC AGT 5’ m RNA: 5’ AUG CCA GUA GGC CAC UUG UCA 3’ protein: Met Pro Val Gly His Leu Ser Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.

Question

Want to see the full answer?

Answer 1

Question

Chapter 26, Problem 26.66AP

Interpretation Introduction

Interpretation:

For the synthesis of metenkephalin, the mRNA sequence has to be synthesized.

Concept Introduction:

Codon: A sequence of three ribonucleotides in the mRNA chain that codes for a specific amino acid; also a three-nucleotide sequence that is a stop codon and stops translation.

Genetic code: The sequence of nucleotides, coded in triplets (codons) in mRNA that determines the sequence of amino acids in protein synthesis.

Illustrated relationships are:

**DNA informational strand: 5’ ATG CCA   GTA GGC CAC   TTG   TCA 3’

DNA Template strand:         3’ TAC GGT   CAT CCG GTG   AAC   AGT 5’

mRNA:                                  5’ AUG CCA GUA GGC CAC UUG   UCA 3’

protein:**                                      Met    Pro     Val    Gly     His    Leu      Ser

Notice: 5’ end of the mRNA strand codes for the N-terminal amino acid, whereas the 3’ end of the mRNA strand codes for the C-terminal amino acid. Proteins are always written N-terminal to C-terminal, reading left to right.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

A normal hemoglobin protein has a glutamic acid at position 6; in sickle-cell hemoglobin, this glutamic acid has been replaced by a valine. List all the possible mRNA codons that could be present for each type of hemoglobin. Can a single base change result in a change from Glu to Val in hemoglobin?

Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’

The amino acid glycine is encoded by four codons: GGA, GGC, GGG, and GGU. Which of the following statements correctly explains this fact? The glycine anticodon contains the sequence CC, but the 5' base of the anticodon can pair nonspecifically with the 3' base of the codon. The glycine anticodon contains the sequence CC, but the 3' base of the anticodon can pair nonspecifically with the 5' base of the codon. Glycine tRNA has four anticodons, and the appropriate anticodon specifically pairs with the correct codon. There are four tRNAs for glycine, each of which has an anticodon that specifically pairs with the correct codon. all of the above