Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 26, Problem 4AL
You are studying RNA viruses and have discovered a new one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don’t know if it is plus or minus stranded. Your lab-mate says, “Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome.” You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate’s suggestion?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You are studying RNA viruses and have discovered a new one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don’t know if it is plus or minus stranded. Your lab-mate says, “Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome.” You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate’s suggestion?
The smallpox virus, which actually has a fairly large genome size for a virus (about 190,000 base
pairs), must use which of the following enzymes to replicate its nucleic acid?
A. DNA-dependent-DNA-polymerase
B. RNA-dependent-DNA-polymerase
C. DNA-dependent-RNA-polymerase
D. RNA-dependent-RNA-polymerase
E. reverse transcriptase
Which of the following experimental results was NOT evidence that DNA is the genetic molecule rather than proteins?
a.
When a virus was radioactively labelled, and the virus was allowed to infect a bacteria cell, radioactive virus DNA was found inside the bacteria cell while radioactive virus proteins were found outside the cell.
b.
Dead pathogenic bacteria cells combined with living nonpathogenic bacteria cells caused the creation of living pathogenic cells and thus the death of the host animal.
c.
Proteins are a class of macromolecules with the diversity and specificity needed for hereditary material.
d.
Nucleotide bases occur regularly, such that the number of adenines = number of thymines, and the number of guanines = number of cytosines.
Chapter 26 Solutions
Prescott's Microbiology
Ch. 26.1 - List some characteristics used in classifying...Ch. 26.1 - Prob. 2CCCh. 26.2 - Prob. 1MICh. 26.2 - Why do you think T4 evolved to initiate DNA...Ch. 26.2 - What function does HMC glycosylation serve?Ch. 26.2 - Explain why the T4 genome is circularly permuted.Ch. 26.2 - Prob. 1.2CCCh. 26.2 - How is a prophage induced to become active again?Ch. 26.2 - Describe the roles of cII, CIII, repressor (CI),...Ch. 26.2 - How do the temperate phages Mu and P1 differ from...
Ch. 26.2 - How is the envelope of this virus formed? How does...Ch. 26.2 - Why do cold sores recur throughout the lifetime of...Ch. 26.2 - In what part of the host cell does a herpesvirus...Ch. 26.2 - Many small DNA viruses rely on host enzymes for...Ch. 26.3 - Why is the X174 genome considered plus stranded?Ch. 26.3 - Why is it necessary for some ssDNA viruses to...Ch. 26.3 - Prob. 2CCCh. 26.3 - How do parvoviruses trick the host DNA polymerase...Ch. 26.4 - The rotavirus genome encodes 12 proteins. Suggest...Ch. 26.4 - Describe the life cycle of 6 phage. What makes...Ch. 26.4 - Prob. 3CCCh. 26.4 - In what ways are the life cycles of 6 and...Ch. 26.5 - Where in the host does the plus-strand RNA genome...Ch. 26.5 - How do some plus-strand viruses use polyproteins...Ch. 26.5 - What is an IRES? Why is it important?Ch. 26.5 - Prob. 3CCCh. 26.6 - How does that use of a segmented genome by...Ch. 26.6 - Prob. 2CCCh. 26.7 - Prob. 1MICh. 26.7 - Prob. 1CCCh. 26.7 - Prob. 2CCCh. 26.7 - Prob. 3CCCh. 26.8 - Prob. 1CCCh. 26.8 - Trace the HBV multiplication cycle, paying...Ch. 26 - Prob. 1RCCh. 26 - Prob. 2RCCh. 26 - Prob. 3RCCh. 26 - Prob. 4RCCh. 26 - No temperate RNA phages have yet been discovered....Ch. 26 - The choice between lysogeny and lysis is...Ch. 26 - Prob. 3ALCh. 26 - You are studying RNA viruses and have discovered a...Ch. 26 - Prob. 5ALCh. 26 - Prob. 6AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Some DNA vaccines use a brief and small electrical shock to get DNA in plasmids into cells. What advantage would there be in using DNA vaccines that consist of plasmids instead of just pieces of double-stranded DNA? The new Covid19 vaccine produced by two companies (Pfizer, Moderna) uses mRNA coding for part of the spike protein of the virus. The virus uses the spike protein to invade human cells where it replicates. Is it surprising that the mRNA must be stabilized with chemicals that need ultra-cold or frozen storage to protect the mRNA from degradation before it causes human muscle cells to make the spike protein? Why not just inject the double-stranded cDNA that codes for the spike protein of the virus? What additional step or steps would you need to use to get the human muscle cells to produce the spike protein if the cDNA was injected to serve as the virus?arrow_forwardA genetics instructor designs a laboratory experiment to study the effects of UV radiation on mutation in bacteria. In the experiment, the students spread bacteria on petri plates, expose the plates to UV light for different lengths of time, place the plates in an incubator for 48 hours, and then count the number of colonies that appear on each plate. The bacteria that have received more UV radiation should have more pyrimidine dimers, which block replication; thus, fewer colonies should appear on the plates exposed to UV light for longer periods. Before the students carry out the experiment, the instructor warns them that while the bacteria are in the incubator, the students must not open the incubator door unless the room is darkened. Why should the bacteria not be exposed to light?arrow_forwardthe human immunodeficiency virus HIV uses RNA rather than DNA to encode genetic information. During infection, however, HIV uses an enzyme known as reverse transcriptase to generate double-stranded DNA. Generally speaking, how would the enzyme generate a double strand of DNA from a single strand of RNA?arrow_forward
- After entering cells, viruses use the host cell machinery to transcribe their viral DNA into RNA or make new copies of their RNA, which will then be translated into proteins that are needed for virus function and replication. There has been a lot of interest and some progress in the development of anti-viral drugs that act to halt the viral replication cycle. Do you think it would effective to target a drug to cellular RNA polymerase to halt viral replication? Why or Why not?arrow_forwardDraw replication forks that show what you would expect to see if a cell were unable to make the following enzymes: DNA Polymerase Helicase Primase Ligasearrow_forwardYou are studying a new virus with a DNA genome of 12 Kb. It can synthesize DNA at a rate of 400 nucleotides per second. If the virus uses rolling-circle replication, how long will it take to replicate its genome? Answer only for the first strand; ignore replication along the displaced strand. O 7.5 seconds O 15 seconds O 30 seconds O 1 minute O 2 minutesarrow_forward
- The sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardHow does DNA replication occur in a precise manner to ensure that identical genetic information is put into the new chromatid? See Figures 8.12 and 8.13. FIGURE 8.12 In DNA replication, the two polynucleotide strands uncoil, and each is a template for synthesizing a new strand. A replicated DNA molecule contains one new strand and one old strand. This mechanism is called semiconservative replication. FIGURE 8.13 A close-up look at the process of DNA replication. (a) As the strands uncoil, bases are added to the newly synthesized strand by complementary base pairing with bases in the template strand. The new bases are linked together by DNA polymerase. (b) DNA synthesis can proceed only in the 5 3 direction; newly synthesized DNA on one template strand is made in short segments and linked together by the enzyme DNA ligase.arrow_forwardGiven the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'arrow_forward
- During the process of protein synthesis on a ribosome, when the large ribosomal subunit covalently attaches an amino acid to a growing polypeptide, what is the name of this newly formed covalent bond? the phosphodiester bond the peptide bond the aminoacyl bond the ether bond the glycosidic bond The ability of F+ cells, or Hfr cells, to transfer plasmid DNA to an F- cell is properly called: transversion transformation conjugation transduction transitionarrow_forwardWhat is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 'arrow_forwardWhich of the following statements below is incorrect? * A. the genetic code is overlapping B. the genetic code is universal C. degenerate codon specify the same amino acids D. the genetic code is triplet Which protein can break covalent bond? * A. Helicase B. Primase C. SSB D. DNA gyrase What is the complementary hnRNA base sequence produced from the DNA base sequence 5' C-T-A-T-A-C 3'? * A. 3' C-A-T-A-T-C 5' B. 3' G-A-T-A-T-G 5' C. 3' G-A-U-A- U-G 5' D. 3' C-U-A-U-A-G 5' Which of the following statements concerning the " cloverleaf" shape of tRNA molecules is correct? * A. four hairpin loops are present B. three hairpin loops and one open end are present C. two hairpin loops and two open ends are present…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
1) Cell Culture Tutorial - An Introduction; Author: Applied Biological Materials - abm;https://www.youtube.com/watch?v=RpDke-Sadzo;License: Standard youtube license