(a)
Interpretation:
It should be determined that whether the given base sequences are sticky or not sticky.
Concept Introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
(b)
Interpretation:
It should be determined that whether the given base sequences are sticky or not sticky.
Concept introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
(c)
Interpretation:
It should be determined that whether the given base sequences are sticky or not sticky.
Concept introduction:
A base is nitrogen containing heterocyclic compound which is found in DNA and RNA.
There are mainly four nitrogen bases found in DNA and they are,
- (1) Adenine
- (2) Guanine
- (3) Cytosine
- (4) Thymine
Short stretches of single stranded DNA are sticky (complementary) to each other. If both ends are cut with the same enzyme, the sticky ends will stick together by complementary base pairing, forming hydrogen bonds.
In DNA, Adenine always makes a double bond with thymine (
Want to see the full answer?
Check out a sample textbook solutionChapter 27 Solutions
Fundamentals of General, Organic, and Biological Chemistry, Books a la Carte Edition; Modified Mastering Chemistry with Pearson eText -- ValuePack ... and Biological Chemistry (4th Edition)
- Each of the following pairs of primers has a problem with it. Tell why the primers would not work well. (a) Forward primer 5'GCCTCCGGAGACCCATTGG 3' Reverse primer 5'TTCTAAGAAACTGTTAAGG 3' (b) Forward primer 5'GGGGCCCCTCACTCGGGGCCCC 3'Reverse primer 5'TCGGCGGCCGTGGCCGAGGCAG 3' (c) Forward primer 5'TCGAATTGCCAATGAAGGTCCG 3'Reverse primer 5'CGGACCTTCATTGGCAATTCGA 3'arrow_forwardAre the following base sequences sticky or not sticky? Each piece is written 5′ to 3′.(a) TTAGC and GCTAA(b) CGTACG and CCTTCGarrow_forwardThe DNA sequence you use will be the following: T - A - G - C - C - A. You will need to make the complementary strand - fill in the table below with the complementary base pairs (remember Chargaff’s rule: A = T and C = G) 5’ T A G C C A 3’ 3’ 5’arrow_forward
- Given the sequence shown below, write the complementary DNA sequence, using the base-pairing rules, as well as the directionality of the strands: 5'- CGAGGCTAGGTTAACCTG-3'arrow_forwardb) For a DNA strand with the given genetic code of bases , undergoing transcription, what will be the complimentary RNA strand? Provide the direction as well as 5" and 3" indicators for the new genetic genome. 5" G-A-A-C-T-G-G-A^T-T-C-T-A-C-C3'.arrow_forwardThe enzymes BamH I and Bal II recognise different sequences but leave the same stickyends: BamH I: ----------G|G A T C C ------ Bal II: ----------A|G A T C T ------(i)Will the two enzymes result in the same number of fragments in a random DNAsequence? Give reasons.(ii)What’s the advantage of having such a pair of REs? Explain with example.arrow_forward
- A duplex DNA molecule contains a random sequence of the four nucleotides with equal proportions of each. What is the average spacing between consecutive occurrences of the sequence 5'-ATGC-3'? Between consecutive occurrences of the sequence 5'-TACGGC-3'?arrow_forwardWhich of the following DNAs is most likely to contain the recognition sequence for a homodimeric DNA binding protein? (Note that only one strand of the DNA is shown - you will find it helpful to write down the sequence and the sequence of the opposite strand to answer this question.) a) 5’- G A G C G A T C G C T C - 3’ b) 5’- G A G C G A G A G C G A - 3’ c) 5’- G A G C G A A G C G A G - 3’arrow_forwardIf the recognition sequence of the restriction enzyme HindiIl is AAGCTT, then how many covalent bonds will be broken by the enzyme in the following DNA molecule? 5'-T-C-A-A-G-C-T-T-C-G-A-A-G-C-T-T-G-A-3 3-A-G-T–T-C-G-A-A-G-C -T-T-C-G-A-A-C-T-5 А. 1 В. 2 С.3 D. 4arrow_forward
- Draw the structure of a G ∙ U base pair.arrow_forwardFor a closed-circular DNA molecule of 6,825 base pairs in the fully relaxed form, the linking number (Lk) is: 65 6825 650 700arrow_forwardIf the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON