Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 29, Problem 16P
Interpretation Introduction
Interpretation:
To determine the Phe enzyme residue that has a major role in DNA strand separation and the domain in which this is present.
Concept introduction:
DNA or Deoxyribonucleic acid is a molecule made of two chains which coil around one another. These form a double helix which carries instructions genetical in nature like related to reproduction, growth, development, functioning of the living organisms.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:
a)requires all four ribonucleoside triphosphates and a DNA template.
b)can extend an RNA chain and initiate a new chain.
c)recognizes specific start signals in DNA.
d)produces an RNA polymer that begins with a 5'-triphosphate.
e)is required for the synthesis of mRNA, rRNA, and tRNA in E. coli.
Replication:- what other enzymes are involved in the initiation phase?- explain the role of primers in this phase- how is the building of the leading strand different from that of the lagging strand?
a. Replicate this sense strand to create a double-stranded DNA helix. Write your answers in CAPS LOCK with NO SPACES between the nucleotides - e.g. ATGCCGAG.....
TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT
complementary strand:
b. Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. Write your answers using the three letter abbreviation for each amino acid.
polypeptide sequence:
does the sense strand DNA sequence have 5’ and 3’ UTR sequences?
5'UTR =
3'UTR =
Chapter 29 Solutions
Biochemistry
Ch. 29 - Prob. 1PCh. 29 - The Events in Transcription Initiation Describe...Ch. 29 - Substrate Binding by RNA Polymerase RNA polymerase...Ch. 29 - Comparison of Prokaryotic and Eukaryotic...Ch. 29 - Prob. 5PCh. 29 - Prob. 6PCh. 29 - Prob. 7PCh. 29 - Alternative Splicing Possibilities Suppose exon 17...Ch. 29 - Prob. 9PCh. 29 - Prob. 10P
Ch. 29 - Post-transcriptional Modification of Eukaryotic...Ch. 29 - Prob. 12PCh. 29 - Prob. 13PCh. 29 - The Lariat Intermediate in RNA Splicing Draw the...Ch. 29 - Prob. 15PCh. 29 - Prob. 16PCh. 29 - Prob. 17PCh. 29 - Prob. 18PCh. 29 - Figure 29.15 highlights in red the DNA phosphate...Ch. 29 - Chromatin decompaction is a preliminary step in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Helicase Unwinding of the E. coli Chromosome Hexameric helicases, such as DnaB, the MCM proteins, and papilloma virus El helicase (illustrated in Figures 16.22 to 16.25), unwind DNA by passing one strand of the DNA duplex through the central pore, using a mechanism based on ATP-dependent binding interactions with the bases of that strand. The genome of E. coli K12 consists of 4,686,137 nucleotides. Assuming that DnaB functions like papilloma virus El helicase, from the information given in Chapter 16 on ATP-coupled DNA unwinding, calculate how many molecules of ATP would be needed to completely unwind the E. coli K 12 chromosome.arrow_forwardFunctional Consequences of Y-Family DNA Polymerase Structure The eukaryotic translesion DNA polymerases fall into the Y family of DNA polymerases. Structural studies reveal that their fingers and thumb domains are small and stubby (see Figure 28.10). In addition, Y-family polymerase active sites are more open and less constrained where base pairing leads to selection of a dNTP substrate for the polymerase reaction. Discuss the relevance of these structural differences. Would you expect Y-family polymerases to have 3-exonuclease activity? Explain your answer.arrow_forwardNumber of Okazaki Fragments in E. coli and Human DNA Replication Approximately how many Okazaki fragments are synthesized in the course of replicating an E. coli chromosome? How many in replicating an “average� human chromosome?arrow_forward
- Multiple Replication Forks in E. coli II On the basis of Figure 28.2, draw a simple diagram illustrating replication of the circular E. coli chromosome (a) at an early stage, (b) when one-third completed, (c) when two-thirds completed, and (d) when almost finished, assuming the initiation of replication at oriC has occurred only once. Then, draw a diagram showing the E. coli chromosome in problem 3 where the E. coli cell is dividing every 20 minutes.arrow_forwardA fragment of bacterial DNA reads: 3’ -TACCTATAATCTCAATTGATAGAAGCACTCTAC- 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would he transcribed? (Hint: Be sure to identify the initiation site.)arrow_forwardComparing the Mechanisms of Action of EF-Tu/EF-Ts and DnaK/ GrpE (Integrates with Chapter 30.) In what ways are the mechanisms of action of EF-Tu/EF-Ts and Dna K/GrpE similar? What mechanist ic functions do the ribosome A-site and DnaJ have in common?arrow_forward
- Multiple Replication Forks in E. coli I Assuming DNA replication proceeds at a rate of 750 base pairs per second, calculate how long it will take to replicate the entire E. coli genome. Under optimal conditions, E. coli cells divide every 20 minutes. What is the minimal number of replication forks per E. coli chromosome in order to sustain such a rate of cell division?arrow_forwarda) Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT b) Using this DNA double helix, express the gene – i.e. determine the resulting polypeptide sequence by using the correct reading frame. When you get to the stop codon – you may write an asterisk (i.e. a “*”) to denote the stop codon. c) Does the sense strand DNA sequence have 5’ and 3’ UTR sequences? If so – write them in the space below 5’ UTR: 3’ UTR:arrow_forwardIllustrating the importance of triphosphate and monophosphate molecules, explain the process of RNA biosynthesis by RNA polymerase.arrow_forward
- RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?arrow_forwardBoth DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differencesbetween the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.arrow_forwardThe overall structures of RNA polymerase and DNA polymerase are very different, yet their active sites show considerable similarities. What do the similarities suggest about the evolutionary relationship between these two important enzymes?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license