Biochemistry
6th Edition
ISBN: 9781305577206
Author: Reginald H. Garrett, Charles M. Grisham
Publisher: Cengage Learning
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 29, Problem 3P
Substrate Binding by RNA Polymerase RNA polymerase has t binding sites for ribonucleoside triphosphates: the initiation site and the elongation site. The initiation site has a greater
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Di- and trinucleotides are occasionally released from RNA polymerase at the very start of transcription, a process called abortive cycling. This process requires the restart of transcription. Suggest a plausible explanation for abortive cycling.
Transcription AttenuationHow would transcriptionof the E. coli trp operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) betweenthe leader peptide gene and sequence 2(b) Increasing the distance between sequences 2 and 3(c) Removing sequence 4(d) Changing the two Trp codons in the leader peptidegene to His codons(e) Eliminating the ribosome-binding site for the genethat encodes the leader peptide(f) Changing several nucleotides in sequence 3 so thatit can base-pair with sequence 4 but not with sequence 2
RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?
Chapter 29 Solutions
Biochemistry
Ch. 29 - Prob. 1PCh. 29 - The Events in Transcription Initiation Describe...Ch. 29 - Substrate Binding by RNA Polymerase RNA polymerase...Ch. 29 - Comparison of Prokaryotic and Eukaryotic...Ch. 29 - Prob. 5PCh. 29 - Prob. 6PCh. 29 - Prob. 7PCh. 29 - Alternative Splicing Possibilities Suppose exon 17...Ch. 29 - Prob. 9PCh. 29 - Prob. 10P
Ch. 29 - Post-transcriptional Modification of Eukaryotic...Ch. 29 - Prob. 12PCh. 29 - Prob. 13PCh. 29 - The Lariat Intermediate in RNA Splicing Draw the...Ch. 29 - Prob. 15PCh. 29 - Prob. 16PCh. 29 - Prob. 17PCh. 29 - Prob. 18PCh. 29 - Figure 29.15 highlights in red the DNA phosphate...Ch. 29 - Chromatin decompaction is a preliminary step in...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- The Events in Transcription Initiation Describe the sequence of events involved in the initiation of transcription by E. coil RNA polymerase. Include in your description those features a gene must have for proper recognition and transcription by RNA poIymerase.arrow_forwardOnce an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunit and bind other proteins known as elongation factors before it begins moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why can't RNA polymerase + sigma factor do all of transcription? Be specific.arrow_forwardInitiation of transcription in prokaryotes occurs at very specific sequences called promoters. Describe or explain what happens when an RNA polymerase with its sigma subunit encounters a promoter sequence in the DNA and how or why that enables transcription to begin there. Be specific.arrow_forward
- Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA orrRNA. (Please note that I am not looking for the function of the 5’ cap, but for the mechanismrestricting capping to messenger RNA.)arrow_forward88Sequential binding of RNA polymerase II-TFIIF complex, TFIIE, and TFIIH completes ___________________ formation. A.pre-initiation complexb.TF recognition elementc.pre-elongation complexD.TATA binding complex 89Which of the following is the GDP-GTP exchange protein?A.EF-Tub.none of the abovec.EF-TsD.EF-G 90RNA polymerase II has 14 subunits. Yesornoarrow_forwardInitiation of transcription in prokaryotic cells requires not only RNA polymerase, but also an "initiation factor" called the sigma factor or sigma subunit. Why can't the core RNA polymerase, without its sigma subunit, initiate transcription?arrow_forward
- The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ a. Mark the point at which transcription will terminate. b. Is this terminator rho independent or rho dependent? c. Draw a diagram of the RNA that will be transcribed from this DNA, including its nucleotide sequence and any secondary structures that form.arrow_forwardMany promoter regions contain CAAT boxes containing consensus sequences CAAT or CCAAT approximately 70 to 80 bases upstream from the transcription start site. How might one determine the influence of CAAT boxes on the transcription rate of a given gene?arrow_forwardDescribe the allosteric and torpedo models for transcriptional termination of RNA polymerase II. Which model is more similar to ρ-dependent termination in bacteria and which model is more similar to ρ-independent termination?arrow_forward
- Discuss possible “molecular ways” that the cAMP-CAP complex and lac repressor may influence RNA polymerase function. In other words, try to explain how the bending and looping in DNA may affect the ability of RNA polymerase to initiate transcription.arrow_forwardin the lac operon, both the operator (o1) and the binding site for CRP–cAMP show rotational symmetry. This is not true of the promoter (theRNA polymerase binding site) as a whole. Why do youthink the promoter does not exhibit rotational symmetry?arrow_forwardOnce an RNA polymerase has initiated transcription, it will release the sigma factor or sigma subunits or bind other proteins known as elongation factors before it begin moving down the DNA template doing strand elongation. Briefly explain why this is necessary - why cant RNA polymerase + sigma factor do all of transcription?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY