BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
9th Edition
ISBN: 9781319425784
Author: BERG
Publisher: Macmillan Higher Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 30, Problem 11P
Interpretation Introduction
Interpretation:
The distance of transcription bubble on E.coli genes which are being transcribed at a maximal rate should be determined.
Concept introduction:
RNA synthesis (transcription) is the synthesis of an RNA molecule from the nucleotide’s adenine, cytosine, guanine, or uracil. The
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
E32. In the technique of DNase I footprinting, the binding of a protein
to a region of DNA protects that region from digestion by DNase I
by blocking the ability of DNase I to gain access to the DNA. In
the DNase I footprinting experiment shown here, a researcher
began with a sample of cloned DNA 400 bp in length. This DNA
contained a eukaryotic promoter for RNA polymerase II. The
assembly of general transcription factors and RNA polymerase II
at the core promoter is described in Chapter 12 (see Figure 12.14).
For the sample loaded in lane 1, no proteins were added. For the
sample loaded in lane 2, the 400-bp fragment was mixed with
RNA polymerase II plus TFIID and TFIIB.
2
400
350
250
175
50
Which region of this 400-bp fragment of DNA is bound by RNA
polymerase II and TFIID and TFIIB?
||
III ||| | ||||
protein. You create a mouse line with Cas9 under control of a brain-specific enhancer, while the short
guide RNA complementary to the first exon of Gene Y is expressed in all tissues. You subsequently
sequence Gene Y in both brain and liver tissue. What would expect in each tissue? You can assume
that the CRISPRICas9 system will impact both copies of Gene Y in cells, and that the first exon of
Gene Y is necessary for Gene Ys function.
a. Liver: Functional Gene Y; Brain: Functional Gene Y
b. Liver: Nonfunctional Gene Y; Brain: Funtional Gene Y
c. Liver: Functional Gene Y; Brain: Nonfunctional Gene Y
d. Liver: Nonfunctional Gene Y; Brain: Nonfunctional Gene Y
Yes or no only.
rna seq can provide sequence and expression data
do riboprobes synthesize bu in vitro transcription?
does rna causes mutations and lose of function of specific genes?
Chapter 30 Solutions
BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- RNA transcription reach low error rate under non-equilibrium steady state, what is the energy source to drive transcription ?arrow_forwardPart I. Structure-Function Relationships in Genes 1. Consider the "two-line model" of a gene shown below - each line represents one strand of a DNA double helix, and the transcription start site is indicated as +1. Use the two-line models provided when answering the following questions. 3' 5' +1 Assume that you know RNA polymerase will move to the right during transcription. On the diagram above, do the following: • Label "upstream" and "downstream" on this gene • Label where you would find the promoter min I • Draw a box where you would expect to find the TATA box • Draw a third line below the model representing the RNA transcript (label the ends!) • Label one of the DNA strands as the template strand 3' 2. Now, let's try that again! This time assume that you know RNA polymerase will move to the left during transcription. Repeat the same tasks as before on the diagram below: 5' 5' 3' +1 I I 5' 3'arrow_forward. Why is a nonsense suppressor tRNATyr, even though ithas a mutant anticodon that cannot recognize a tyrosinecodon, charged with tyrosine by Tyr tRNA synthetase?arrow_forward
- E22. The method of Northern blotting is used to determine the amount and size of a particular RNA transcribed in a given cell type. Alternative splicing (discussed in Chapter 12) produces mRNAs of different lengths from the same gene. The Northern blot shown here was made using a DNA probe that is complementary to the MRNA encoded by a particular gene. The mRNA in lanes 1 through 4 was isolated from different cell types, and equal amounts of total cellular MRNA were added to each lane. 2 3 4 Lane 1: MRNA isolated from nerve cells Lane 2: MRNA isolated from kidney cells Lane 3: MRNA isolated from spleen cells Lane 4: MRNA isolated from muscle cells Explain these results. | |arrow_forward. Outline an experimental approach to determining the average chain growth rate for transcription in vivo. Chain growth rate is the num- ber of nucleotides polymerized per minute per RNA chain.arrow_forwardSequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?arrow_forward
- . Outline an experimental approach to determining the average chain growth rate for transcription in vivo. Chain growth rate is the number of nucleotides polymerized per minute per RNA chain.arrow_forwardplease help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forwardQ34. mRNA decay (breakdown) can play an important role in controlling protein abundance. Which of the following scenarios correctly describes a relationship between mRNA decay and protein abundance? A. A decrease in transcription with an increase in the rate of mRNA decay can result in increased protein abundance. B. An increase in transcription with an increase in the rate of mRNA decay can result in no change in protein abundance. C. An increase rate of protein synthesis but failure to form an apoprotein can be explained by a decrease in mRNA decay. D. None of the abovearrow_forward
- AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forwardInitiation during transcription: Does a polymerization reaction (when an RNA polymerase breaks apart the phosphate bond for energy during transcription) happen in eukaryotes?arrow_forwardAssuming alternative splicing can generate all permutations and combinations. How many proteins could a gene with three exons and two introns generate?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON