Concept explainers
(a)
Interpretation:
The autoradiographic pattern for strands (i) to (v) should be determined.
Concept introduction:
DNA synthesis can be defined as the process by which the deoxynucleic acids such as adenine, thymine, cytosine, and guanine are associated together to form DNA.
RNA synthesis (transcription) is the synthesis of an RNA molecule from the nucleotide’s adenine, cytosine, guanine, or uracil. The
(b)
Interpretation:
The possible effect of rifampicin on the RNA synthesis in the given system should be determined.
Concept introduction:
DNA synthesis can be defined as the process by which the deoxynucleic acids such as adenine, thymine, cytosine, and guanine are associated together to form DNA.
RNA synthesis (transcription) is the synthesis of an RNA molecule from the nucleotide’s adenine, cytosine, guanine, or uracil. The nucleotides are combined together by the enzyme RNA Polymerase.
(c)
Interpretation:
The reason for the difference between the heparin blocks the elongation of RNA primer before the transcription but not after should be determined.
Concept introduction:
DNA synthesis can be defined as the process by which the deoxynucleic acids such as adenine, thymine, cytosine, and guanine are associated together to form DNA.
RNA synthesis (transcription) is the synthesis of an RNA molecule from the nucleotide’s adenine, cytosine, guanine, or uracil. The nucleotides are combined together by the enzyme RNA Polymerase.
(d)
Interpretation:
The length of the longest product in the absence of four ribo-nucleoside triphosphate should be determined.
Concept introduction:
DNA synthesis can be defined as the process by which the deoxynucleic acids such as adenine, thymine, cytosine, and guanine are associated together to form DNA.
RNA synthesis (transcription) is the synthesis of an RNA molecule from the nucleotide’s adenine, cytosine, guanine, or uracil. The nucleotides are combined together by the enzyme RNA Polymerase.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 30 Solutions
BIOCHEMISTRY (LOOSELEAF)-W/ACCESS
- Please help me solve this problem. I am really having a hard time understanding this lesson. Please help. Kindly provide all the necessary information to this problem. Thank you! Please answer numbers 1-5 determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Note: Prepare the partner strand of this DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain. 1. Partner DNA strand 2. the mRNA strand 3. The tRNA 4. the formed amino acids 5. the discussion of the entire procedurearrow_forwardClose contact. Examination of the structure of DNA polymerases bound to nucleotide analogs reveals that conserved residues come within van der Waals contact of C-2'C-2' of the bound nucleotide. What is the potential significance of this interaction?arrow_forwardplease help me with thi question. What advantages do CRISPR‑Cas systems have over restriction enzymes and engineered nucleases for editing DNA? The options are attached. Multiple answers can be chosenarrow_forward
- RNA is transcribed. Label the 5′ and 3′ ends of each strand. 17. The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is 5′ and which end is 3′? b. Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.arrow_forwardNeed help ASAP. How do you use FISH(fluorescence in situ hybridization) to detect gene rearrangement? Describe an example with the detail of the disease and the procedure.arrow_forwardneed help. For both question 20. The proofreading ability of DNA polymerase which depends on its native exonuclease activity occurs in the: A. 5' to 3' direction B. 3 to 5' direction 21. Direct repair mechanisms in plants involve the enzyme: A Photolvase B. Convertese C. Hydrolase D. Phosphodiesterasearrow_forward
- . Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forwardAn extra piece. In one type of mutation leading to a form of thalassemia, the mutation of a single base (G to A) generates a new 3' 3' splice site (blue in the illustration below) akin to the normal one (yellow) but farther upstream. Normal 3' end of intron 5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3' 5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3' What is the amino acid sequence of the extra segment of protein synthesized in a thalassemic patient having a mutation leading to aberrant splicing? The reading frame after the splice site begins with TCT.arrow_forwardorganisms ha varieties. Through this process, several genetically (10) been produced. What I Can Do Activity 7: MATCHY MATCHY Direction: Match the purpose to the components found in the box below. Antibiotic Resistance Gene Multiple Cloning Site Promoter DNA Inserted Gene Sequence Multiple Cloning Site 1. Allows the controlled expression of the desired gene in the presence of an inducing agent (e.g., beta-galactosidase; heat treatment (~65°"C) 2. DNA sequence or portion for the insertion of the desired gene. This section may contain sequences that will be cut by specific restriction endonucleases ( cuts within the molecule) 3. Successful insertion of a gene allows the expression of its protein product. This usually provides a specific trait to the "transformed" bacteria. 4. Provides a way to screen a population of bacteria for those that took up the plasmid. For example, if an ampicillin resistance gene is encoded in the plasmid, then only bacteria 10 t4arrow_forward
- How many sites? A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-base-pair site. Would this enzyme be useful in protecting cells from viral infections, given that a typical viral genome is 50,000 base pairs long? Explainarrow_forwardI am more confused. how about we start from begining, you post answers on here, and then we go from there? 1. Identify the open reading frame in the following DNA sequence, the protein that this gene encodes for, its function, and the source. 2. "Look carefully at the DNA sequence and identify the start site for transcription" 3. Click on the DNA sequence from the start site of transcription, select all of the sequence, and copy the sequence. Go to the National Center for Biotechnology Information (NCBI) website http://www.ncbi.nlm.nih.gov/. Click on BLAST on the right-hand side under “Popular Resources.” BLAST is a program that will allow you to find the protein sequence for the DNA sequence (gene) you submit. Next click on blastx (translated nucleotide protein). Paste the DNA sequence into the box under “Entry Query Sequence.” Scroll down and click BLAST. The search may take a few seconds; the page will keep updating until the search is completed. You do not need to enter any…arrow_forwardCloning vectors for E Coli. For each of the following items, describe what it is explain the necessity for each in cloning plasmids that are used for the expression (production) of protein. what would happen if this element was omitted? The Multiple Cloning Site (MCS) Origin of replication – (AmpR) antibiotic resistance gene – T7 promoter - T7 termination site- lac I genearrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)