BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 26P
Interpretation Introduction
Interpretation:
Experimental strategy for switching off the translation of an mRNA without changing the gene sequence encoding the protein should be determined.
Concept introduction:
Messenger RNA (mRNA) is a type of RNA molecule, which transfers genetic information from DNA to the ribosome. The ribosome then read the mRNA chain and produce protein chain, which is termed as the genetic expression. The conversion of DNA to mRNA is termed as transcription, which occurs in the nucleus of the cell. Whereas, the process of gene expression of mRNA to protein (translation) occurs in the cytoplasm of the cell.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript).
Strand 1
3’ End
TTG
CTT
CAC
CTT
GCG
CGC
CCG
CGC
TAA
TTG
5’ end
mRNA
True or False. Explain.
A) At no time during protein synthesis does an amino acid make direct
contact with the mRNA being translated.
B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.
Translation. Write the anti-codon sequence of the MRNA transcript. Translate the
MRNA transcript into peptide sequence using both the 3 letter abbreviation and 1 letter
abbreviation.
ANTI-CODON
3'
5'
SEQUENCE
AMINO ACID
N-
C-
SEQUENCE (3 letter terminus
Abbreviation)
Terminus
AMINO ACID
N-
C-
SEQUENCE (1 letter terminus
Abbreviation)
Terminus
Chapter 31 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Ch. 31 - Prob. 1PCh. 31 - Prob. 2PCh. 31 - Prob. 3PCh. 31 - Prob. 4PCh. 31 - Prob. 5PCh. 31 - Prob. 6PCh. 31 - Prob. 7PCh. 31 - Prob. 8PCh. 31 - Prob. 9PCh. 31 - Prob. 10P
Ch. 31 - Prob. 11PCh. 31 - Prob. 12PCh. 31 - Prob. 13PCh. 31 - Prob. 14PCh. 31 - Prob. 15PCh. 31 - Prob. 16PCh. 31 - Prob. 17PCh. 31 - Prob. 18PCh. 31 - Prob. 19PCh. 31 - Prob. 20PCh. 31 - Prob. 21PCh. 31 - Prob. 22PCh. 31 - Prob. 23PCh. 31 - Prob. 24PCh. 31 - Prob. 25PCh. 31 - Prob. 26PCh. 31 - Prob. 27PCh. 31 - Prob. 28PCh. 31 - Prob. 29PCh. 31 - Prob. 30PCh. 31 - Prob. 31PCh. 31 - Prob. 32PCh. 31 - Prob. 33PCh. 31 - Prob. 34PCh. 31 - Prob. 35PCh. 31 - Prob. 36PCh. 31 - Prob. 37PCh. 31 - Prob. 38PCh. 31 - Prob. 39PCh. 31 - Prob. 40PCh. 31 - Prob. 41PCh. 31 - Prob. 42PCh. 31 - Prob. 43PCh. 31 - Prob. 44PCh. 31 - Prob. 45PCh. 31 - Prob. 46PCh. 31 - Prob. 47PCh. 31 - Prob. 48PCh. 31 - Prob. 49PCh. 31 - Prob. 50PCh. 31 - Prob. 51PCh. 31 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Genome. Wide Association Studies: use chip-based array to correlate disease symptoms to SNPs use genomic sequencing technology to correlate disease symptoms to SNPs use small fragment DNA sequencing technology (e.g., Sanger Sequencing) to correlate disease symptoms to SNPs sequence exomes to identify SNPs involved in disease symptoms monitor protein translation to diagnose diseasearrow_forwardTrue or False. Rho-dependent termination of transcription in prokaryotes can take place upon the formation of a strong RNA stern loop in the MRNA just before a run of U residues. True Falsearrow_forwardWrite TRUE or FALSE. If false, write the word/s that make(s) the statement incorrect. A glycosidic bond connect the phosphate group to ribose. Before the mRNA can be used in translation, it has to undergo splicing, 3’ cap and 5' poly-A tail post-transcription modifications.arrow_forward
- Describe translation. What is the function of the aminoacyl-tRNA synthase?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forwardthe correct reading frame. next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. The reading frame DNA sequence is: The mRNA sequence is: The polypeptide sequence is:arrow_forward
- True or false?: The CTD is responsible for mRNA-processing steps that are specific for mRNA and not for other forms of RNA. Explain why you chose true or false.arrow_forwardGene Expression: Illustrate some steps involved in RNA processing and identify the sequence of amino acids in a polypeptide chain corresponding to the codons in the mRNA. Procedure and Questions: The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. 1. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2. Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends. 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptidearrow_forwardHi Please Help me With this. Original Sequence is also attached in the image:arrow_forward
- Consider an animal. During DNA replication, all base pairs of DNA are copied. But, during transcription, only some of the DNA bases are transcribed. What parts of the DNA or/and protein(s) determines which part of the genome is transcribed into mRNA? (short answer)arrow_forwardAAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene? (Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.) Submit Answer Retry Entire Group No more group attempts remainarrow_forwardGenetic expression involves transcription and translation. Match the structure or molecule to the step site where amino acid combines with tRNA intron sequences are removed and exons are combined together makes RNA more stable in the cytoplasm region of DNA with sequences that combine with RNA polymerase transcribed strand that will go on to translation connects amino acid to polypeptide chain and leaves tRNA site where tRNA with amino acid enters the ribosome recognized by the protein synthesis machinery enzyme that connects RNA nucleotides to DNA template part of tRNA with nucleotides complementary to mRNA 1. peptide bond 2. 3. antisense strand 4. anticodon loop 5. RNA polymerase 5' cap 6. A site 8. 7. splicing 9. promoter region acceptor stem 10. poly-A tailarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY