BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 42P
Interpretation Introduction
Interpretation:
The accuracy level of
The mechanism used to ensure the fidelity of all these processes should be determined.
Concept introduction:
DNA replication is the biological process, in which two identical daughter DNAs are produced from one DNA molecules. It occurs inside the nucleus of the cell. RNA synthesis is the process of transcription, in which one strand of DNA is transcripted into an RNA strand. This process also occurs in the nucleus of the cell. The protein synthesis process is the translation of mRNA into a protein chain. It occurs inside the cytoplasm of the cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Compare the accuracy of DNA replication, RNAsynthesis, and protein synthesis. Which mechanisms are used to ensure the fidelity of each of these processes?
INSTRUCTION:
= IF BOTH STATEMENT ARE TRUE
= IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE
= IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE
= IF BOTH STATEMENTS ARE FALSE
STAMENT 1: If 3’ ATTG 5’ is transcribed, the complementary strands is 5’ UAAC 3’
STAMENT 2: Guanine and Cytosine are purine bases
ANSWER:
STAMENT 1: The general term for the enzyme that connects nucleotide triphosphates in DNA is DNA transferase
STAMENT 2: The enzyme that unwinds the double stranded DNA is topoisomerase
ANSWER:
STAMENT 1: The name of the compound formed when uracil is bonded to ribose is uradine
STAMENT 2: The piece of nucleic acid that is complementary to the DNA template and serves as a starting point of replication is called RNA promoter
ANSWER:
Application/ Analysis
Explain how the anti-parallel structure of DNA predicts its replication mechanism.
Identify the major and minor groove of DNA and explain why they are there.
Differentiate between semiconservative, conservative, and dispersive replication.
Interpret a diagram of a bi-directional replication fork and correctly determine strand polarity and fork direction.
Chapter 31 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Ch. 31 - Prob. 1PCh. 31 - Prob. 2PCh. 31 - Prob. 3PCh. 31 - Prob. 4PCh. 31 - Prob. 5PCh. 31 - Prob. 6PCh. 31 - Prob. 7PCh. 31 - Prob. 8PCh. 31 - Prob. 9PCh. 31 - Prob. 10P
Ch. 31 - Prob. 11PCh. 31 - Prob. 12PCh. 31 - Prob. 13PCh. 31 - Prob. 14PCh. 31 - Prob. 15PCh. 31 - Prob. 16PCh. 31 - Prob. 17PCh. 31 - Prob. 18PCh. 31 - Prob. 19PCh. 31 - Prob. 20PCh. 31 - Prob. 21PCh. 31 - Prob. 22PCh. 31 - Prob. 23PCh. 31 - Prob. 24PCh. 31 - Prob. 25PCh. 31 - Prob. 26PCh. 31 - Prob. 27PCh. 31 - Prob. 28PCh. 31 - Prob. 29PCh. 31 - Prob. 30PCh. 31 - Prob. 31PCh. 31 - Prob. 32PCh. 31 - Prob. 33PCh. 31 - Prob. 34PCh. 31 - Prob. 35PCh. 31 - Prob. 36PCh. 31 - Prob. 37PCh. 31 - Prob. 38PCh. 31 - Prob. 39PCh. 31 - Prob. 40PCh. 31 - Prob. 41PCh. 31 - Prob. 42PCh. 31 - Prob. 43PCh. 31 - Prob. 44PCh. 31 - Prob. 45PCh. 31 - Prob. 46PCh. 31 - Prob. 47PCh. 31 - Prob. 48PCh. 31 - Prob. 49PCh. 31 - Prob. 50PCh. 31 - Prob. 51PCh. 31 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- * REQUIRED 34. The diagram below represents one of a number of different types of mutations that can occur in DNA ....CACTAGCAG.... DNA Sequence mutation ....CACTAACAG.... DNA Sequence This mutation can best be described as the the insertion of an adenine (A) base into both strands of the DNA molecule pairing of an adenine (A) base with thymine (T) the substitution of an adenine (A) base for guanine (G) deletion of an adenine (A) base from the DNA molecule 0 1arrow_forwarda. Propose three different mutations to prevent initiation, elongation, and termination of bacterial DNA replication, respectively. Explain how/why each mutation would prevent its respective step. (Hint: mutations can be in genes that encode proteins or regulatory DNA sequences) b. In the early 1900s, Avery, MacLeod, and McCarty performed an experiment in bacterial cells to determine whether DNA, RNA, or protein functions as the 'transforming molecule' (i.e. the genetic material). In your own words, how did their experiment (depicted in the figure below) help to answer that question?arrow_forwardDNA Olympics (warm up) Name Caitlin MYers Period DIRECTIONS: Complete each of the following “events" in their proper order. In the first event, you must transcribe the proper RNA sequence from the DNA sequence provided. In the next event, you must translate the RNA strand that you have just created and use it to create the proper string of AMINO ACIDS and, eventually, the proper PROTEIN'. When your protein is completed, the final event is to match your protein with its proper trait (ex: tongue rolling). 1. A TGCATGCGCGACTG GGG TC GGAGTGGarrow_forward
- INSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: The term that refers to the synthesis of DNA using the information contained in RNA is called DNA replication STAMENT 2: The number of hydrogen bonds between guanine and cytosine is 3 ANSWER: STAMENT 1: If the %A of bacteria is 30%, then the % (G+C) of the bacteria is 40% STAMENT 2: The DNA is plectonemic because one of the strand go in 5’ to 3’ direction while the other go in the 3’ to 5’ direction ANSWER: STAMENT 1: DNA replication is conservative because one of the strands in the daughter DNA comes from the parent DNA STAMENT 2: In DNA replication, the strand copied into an mRNA is called the leading strand ANSWER:arrow_forwardInstructions: Express your own gene! (1) Make up a DNA sequence of at least 18nucleotides and then (2) show the mRNA sequence that will be made via transcription,(3) show the tRNAs that will base pair and deliver the amino acids, and (4) the aminoacid sequence of the resulting protein. You can use the single letter abbreviations forDNA and RNA nucleotides and the three-letter abbreviations for the amino acids.arrow_forwardINSTRUCTION: = IF BOTH STATEMENT ARE TRUE = IF FIRST STATEMENT IS TRUE WHILE SECOND STATEMENT IS FALSE = IF FIRST STATEMENT IS FALSE WHILE SECOND STATEMENT IS TRUE = IF BOTH STATEMENTS ARE FALSE STAMENT 1: RNA splicing is the step in post transcriptional processing where intervening sequences are removed STAMENT 2: 5’ to 3’ direction is the direction of growth of the peptide chain ANSWER: STAMENT 1: The enzyme that joins the gaps in newly synthesized DNA is called DNA polymerase STAMENT 2: The name of the compound formed when cytosine is bonded to ribose is cytidine ANSWER: STAMENT 1: Codon is a term that refers to the 3-nucleotide code for amino acids in mRNA STAMENT 2: Transition is a kind of mutation where a purine changes to another purine ANSWER:arrow_forward
- Practice: DNA Structure and Replication 1. Label each part of the model to the right. Include specific nitrogen base pairs in your labeling. 2. What molecule is it? 3. What is its purpose? 4. Where can it be found in a prokaryotic cell? 5. Where can it be found in a eukaryotic cell? 6. It gets copied during a process called replication. When does this happen? 7. What is the result of DNA replication? 8. Why is DNA replication necessary? 10. What would the chromosome to the right look like after DNA replication? 11. What would the chromosome to the right be called after DNA replication? 9. Why is DNA replication said to be semi-conservative? Draw a picture to support your answer. TAACCGAGTTCAGA b. TTAACCGAGTTCAGA Genetics Unit Sol Sol Dal 12. Replicate the following four DNA strands using what you know about complementary base pairs. TACOTCCAGATITT a. AATACGTCCAGATTTT c. CCCGCGGAATATACA O book It's Not Rocket Science 2016 d. AGGGCTACTTCAGAC J 7arrow_forwardDistinguish DNA-dependent DNA polymerases, DNA-dependent RNA polymerases, RNA-dependent RNA polymerases, and RNAdependent DNA polymerases in terms of their templates, products synthesized, and proofreading activity, as discussed in this and previous sectionsarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- . Indicate the role of each of the following in DNA replication: (a) topoisomerase, (b) helicase, (c) primase,and (d) ligase.arrow_forward. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forwardShow all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license