The primer that can be used when a reverse transcriptase activity is supposed to be assayed where polyriboadenylate is in the template needs to be determined. Also, the radioactive nucleotide that is to be used to follow chain elongation needs to be determined. Concept introduction: Primer is a single strand of nucleic acid . It is utilized by all the living organisms for the synthesis of DNA. The primers are removed before completion of DNA replication and DNA polymerases fill the gaps in the sequence with DNA. Scientists in the laboratory can design and synthesize DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA. In order to perform the polymerase chain reaction, these DNA primres are commonly used to copy pieces. Shellac primers based on oil, latex and pigmented are three different types of primers

Question

Want to see the full answer?

Answer 1

Question

Chapter 4, Problem 22P

Interpretation Introduction

Interpretation:

The primer that can be used when a reverse transcriptase activity is supposed to be assayed where polyriboadenylate is in the template needs to be determined. Also, the radioactive nucleotide that is to be used to follow chain elongation needs to be determined.

Concept introduction:

Primer is a single strand of nucleic acid. It is utilized by all the living organisms for the synthesis of DNA. The primers are removed before completion of DNA replication and DNA polymerases fill the gaps in the sequence with DNA. Scientists in the laboratory can design and synthesize DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA.

In order to perform the polymerase chain reaction, these DNA primres are commonly used to copy pieces. Shellac primers based on oil, latex and pigmented are three different types of primers

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Preparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?

The structure of a typical pUC19/human DNA recombinant clone. Ensure that you clearly indicate the restriction enzyme sites at the ends of the human DNA insert. Hint: think about the compatibility of the ends generated by partial digestion of human DNA and complete digestion of the vector – will the original sites in the vector be regenerated or not, or it is impossible to predict?

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…