BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
9th Edition
ISBN: 2818000069358
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 18P
Interpretation Introduction
Interpretation:
Why is DNA synthesis performed in 51-31 direction?
Concept introduction:
51 and 31 indicate the number of carbon in DNA sugar backbone. A 51 carbon has phosphate group whereas a 31 carbon has hydroxyl group. The direction of DNA strand is given by this 51 and 31 asymmetry.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to-
3'5'-to-3' direction. Other helicases have been reported to move in
the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why
you would expect helicases to move in one direction or the other?
Read and analyze the question and choices CAREFULLY; more importantly, ALWAYS CHOOSE the BEST answer.
How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside
triphosphates (precursors of RNA strand) differ from each other?
O A. Deoxyribonucleoside triphosphates have an additional sugar residue at the 2' carbon (carbon number 2) in its
deoxyribose. Meanwhile, an amino acid residue is not attached at the 2' carbon of ribonucleoside triphosphates in its
ribose.
O B. Deoxyribonucleoside triphosphates have an oxygen atom at the 2' carbon (carbon number 2) in its deoxyribose.
Meanwhile, an oxygen atom is not attached at the 2' carbon of ribonucleoside triphosphates in its ribose.
OC Deoxyribonucleoside triphosphates have an amino acid residue at the 2' carbon (carbon number 2) of in
deoxyribose. Meanwhile, an oxygen atom is not attached at the 2' carbon of ribonucleoside triphosphates in its
ribose.
OD. Deoxyribonucleoside triphosphates do not have…
Does changing the sequence of nucleotides always result in a different amino acid sequence? Explain
Chapter 4 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Why is this wrong?arrow_forwardIf one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'arrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTarrow_forward
- The hydrogen bonding of the specific pairs of bases shown above provides for ___? Preserving the sequence of genes during DNA replication Transcribing the sequence of DNA into the sequence of RNA Translating the sequence of RNA into the sequence of amino acids in proteinsarrow_forwarda. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?arrow_forwardUsing the Figure below identify: What is the significance of hydrogen bonds in double helix of DN What is a role of base pairs? How genetic information might be stored in the nucleotide sequence of DNA?arrow_forward
- What is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGATarrow_forwardPlease do allarrow_forwardprateins OP (weak bonds) a better source of energy than H,O (strong bonds)? 37. What is the difference between AG, AG, and AG? Which is preferred by biochemists? 38. How can a reaction with a positive AG (like malate-> oxaloacetate) go forward in the cell? 46. Which tautomeric form of each base (A, T, G, and C) is found in standard DNA? What can be the result if the uncommon forms are incorporated into DNA? REarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license