Interpretation:
The reason for the mixture of poly(A), poly(B) and the three DNAs shown in the curve to vary with respect to the C0t value needs to be explained.
Concept introduction:
The C0t value analysis is a technique used to measure the complexity in the size of DNA or gene and this technique is based on DNA renaturation kinetics.
This technique states the following principles:
- Renaturation rate is directly proportional to the number of times the sequences exist on the DNA Strand.
- When enough time is given all the denatured DNA are re-associated or reannealed.
- Renaturation takes the least time when there is more repetition of the sequences.
The renaturation process carried out by heating the DNA and allowing it to cool down to reanneal.
The C0t value depends on − DNA Concentration, reassociation temperature, cation concentration, and viscosity and is given by the equation:
Lower C0t value shows more repetition of sequences while Higher C0t value indicates a greater number of unique sequences.
Want to see the full answer?
Check out a sample textbook solutionChapter 4 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
- DNA Polymerase Holoenzyme IIlI is represented below. It consists of several domains with distinct functions. The structure capable of 5' to 3' DNA polymerization is represented by the letter and the structure capable of 3' to 5' exonuclease activity is represented by the letter B. -D DNA Pol II holoenzyme D; A А; С А;B А А; D В; D O Oarrow_forwardBacteriophage T4 has a linear double-stranded DNA genome, yet mapping many mutations, as shown in Figure, generates a circular linkage map. How might you explain this discrepancy?arrow_forwarda) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…arrow_forward
- Part b plzarrow_forwardvvnicn the following statements are correct about the repair of a DNA duplex containing the sequence below that is grown INE coli (select all that apply)? Strand A Strand B GATCTAGCCGGCATCCGAT CTAGATCGGACGTAGGCTA Methyl ✔A. MutH cleaves Strand A O B. DNA repair will result in the bold A in strand B being replaced with a C O C. DNA repair will result in the bold G in strand A being replaced with a T ✔ D. Defect will not be properly repaired in dam(-) E coli O E. The mammalian repair system would also correct the mismatch shown based on the methylation status of the DNAarrow_forwardthis is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.arrow_forward
- Sum 5 Please help mearrow_forwardBelow is a depiction of a replication bubble. 5' AGCTCCGATCGCGTAACTTT 3' TCGAGGCTAGCGCATTGAAA CTAAAGCTTCGGGCATTATCG 3' GATTTCGAAGCCCGTAATAGC TATCGACS Consider the following primer which binds to the DNA replication bubble on the diagram above: 5'-GCUAUCG-3' Identify the DNA sequence to which this primer would bind and the orientation. If the replication fork moves to the right, will the primer be used to create the leading strand of replication or the lagging strand? Explain your answer b. If the replication fork moves to the left, will the primer be used to create the leading strand of replication or a. the lagging strand? Explain your answer. What would the next five nucleotides added to the primer by DNA polymerase? С.arrow_forwardSuppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)arrow_forward
- 5'-GCGGTACGTTACGGCTTTACTGACCTGCAGGC-3' A. Convert this to a double strand DNA molecule by writing the complementary sequence. Be sure to correctly label the ends of the double stranded molecule B. Pick one of the two strands and write the sequence of an RNA molecule that could be transcribed from it. Again, you must correctly label the ends of the molecule.arrow_forwardBelow is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…arrow_forwardFIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning