Concept explainers
(a)
Interpretation:
The type of the radioactive material needs to be determined that is added to the culture medium considering that DNA is supposed to be radioactively labeled but not RNA, in dividing and growing bacterial cell.
Concept introduction:
Nucleotides are the construction buildings of
(b)
Interpretation:
A product comprising DNA polymerase and primed model DNA must be supplemented with precursors. Also, where core phosphorous atoms are evenly marked with 32P, the location of radioactive atoms in these precursors when the DNA is to be ready should be stated.
Concept introduction:
DNA elongation performs in 5’-3’direction. Chain elongation reaction takes place when 3-hydroxyl group attacks the innermost phosphorus atom of deoxy nucleoside triphosphate. In the
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 4 Solutions
BIOCHEM-ACHIEVE(FIRST DAY DISCOUNTED)
- Restriction digestion and Gel electrophoresis: A single strand of a double-stranded DNA sequence is shown below. Draw a complementary DNA strand and show the restriction digestion pattern of the double-stranded DNA with BamHI and Pst1. Show the separation pattern of the undigested and the digested DNA on your agarose gel. Label the gel appropriately. 5’ – CGAGCATTTGGATCCTGTGCAATCTGCAGTGCGAT – 3’arrow_forwardIn DNA extracting. What is the purpose of clear shampoo in the DNA extraction buffer?arrow_forwardYou have another circular plasmid. Complete and effective digestion of this plasmid with a restriction enzyme yields three bands: 4kb, 2kb, and 1 kb. In comparing the band intensity on an ethidium bromide-stained gel, you notice that the 4 kb and the 2 kb bands have the exact same brightness. The 1 kb band is exactly one fourth as bright as each of these. (Assume there is uniform staining with ethidium bromide throughout the gel.) How many times did the enzyme cut the plasmid? What is the size of the plasmid? Justify your answers to a and b above using a clearly labeled diagram showing the relative location of the cut-sites on the plasmid.arrow_forward
- In the DNA extraction. What is the role of alcohol in the DNA extraction process?arrow_forwardRestriction sites of Lambda (A) DNA - In base pairs (bp) The sites at which each of the 3 different enzymes will cut the same strand of lambda DNA are shown in the maps (see figure 3 B-D), each vertical line on the map is where the respective enzymes will cut. A DNA A (bp) 48502 10 000 20 000 30 000 40 000 9162 17 198 B Sal I 7059 14 885 28 338 35 603 42 900 (bp) Hae III 11 826 21 935 29 341 38 016 (bp) 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864 Figure 3: Restrictrion site map showing the following A) inear DNA that is not cut as reference B) DNA CLt with Sal L C) DNA cut with Hae , D) DNA cut with Eco RI 1. Calculate the size of the resulting fragments as they will occur after digestion and write the sizes on the maps below. Note that linear DNA has a total size of 48 502 bp (see figure 3A). Page 3 of 7 9162 17 198 Sal i (bp) 7059 14 885 28 338 35 603 42 900 Hae I (bp) 11 826 21 935 29 341 38 016 11648 29,624 Eco R1 (bp) 10 592 16 246 28 915 41 864arrow_forwardPreparing plasmid DNA (double stranded, circular) for Sanger sequencing involves annealing a complementary, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to 90°C and then slowly bringing the temperature down to 25°C. Why does this protocol work? What enzyme is used and what other components are required in the sequencing reaction? How does the Sanger method determine the sequence?arrow_forward
- Show all work. 1. A) Produce a double-stranded piece of DNA that is 11 base pairs long using the letters A, C, G, T and label the ends of both strands using 3' and 5' appropriately. B) Calculate the ratio of (A+T)/(G+C) and (A+G)/(C+T). Explain why one ratio will always be equal to 1.0?arrow_forwardQuestion. What would the forward primer sequence look like if it were intended to bind the area of the DNA template?arrow_forwarda.) Explain briefly how silica allows us to purify DNA. Be sure to state the relevant biochemical features of silica and DNA as well as any relevant reagents or steps that are important for the purification. Your answer should explain both how we get the DNA to bind in the first place, and how we are able to remove the DNA. You do not (and should not) explain earlier steps in a DNA purification; focus you answer on the silica:DNA interaction. b.) In theory, can a silica spin column also be used to purify RNA? If so, explain how (and why we did not observe RNA when analyzing plasmid DNA via agarose gel electrophoresis). If not, explain why not.arrow_forward
- O Off target effects are not really a concern. Question 20 What happens after a double stranded break is induced in the DNA? Select the statement that is FALSE. O HR which will lead to a small indel if template DNA is absent O Microhomology-Mediated End Joining O Non-Homologous End Joining O HR if template DNA is present Question 21 See below for four STR profiles from four different boys, as depicted in an electropherogram. The peak localarrow_forwardPick a plasmid . What was its approximate transformation? Express it in # colonies per microgram of DNA transformed. Assume the original DNA was about .001 ug/ul . Count how many colonies you got on one plate (or estimate that number) and figure out how much of the total solution you plated on that plate. Multiply by all the plates, if you plated all of it. OR, if you only plated some of it, figure out how many colonies you would have gotten had you plated all of it. Divide by the number of ug used.arrow_forwardMolecules of DNA Polymerase III per Cell vs. Growth Rate It is estimated that there are 40 molecules of DNA polymerase III per E. coli cell, is it likely that the growth rate of E. coli is limited by DNA polymerase III availability?arrow_forward
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)