The primer that can be used when a reverse transcriptase activity is supposed to be assayed where polyriboadenylate is in the template needs to be determined. Also, the radioactive nucleotide that is to be used to follow chain elongation needs to be determined. Concept introduction: Primer is a single strand of nucleic acid . It is utilized by all the living organisms for the synthesis of DNA. The primers are removed before completion of DNA replication and DNA polymerases fill the gaps in the sequence with DNA. Scientists in the laboratory can design and synthesize DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA. In order to perform the polymerase chain reaction, these DNA primres are commonly used to copy pieces. Shellac primers based on oil, latex and pigmented are three different types of primers

Question

Want to see the full answer?

Answer 1

Question

Chapter 4, Problem 22P

Interpretation Introduction

Interpretation:

The primer that can be used when a reverse transcriptase activity is supposed to be assayed where polyriboadenylate is in the template needs to be determined. Also, the radioactive nucleotide that is to be used to follow chain elongation needs to be determined.

Concept introduction:

Primer is a single strand of nucleic acid. It is utilized by all the living organisms for the synthesis of DNA. The primers are removed before completion of DNA replication and DNA polymerases fill the gaps in the sequence with DNA. Scientists in the laboratory can design and synthesize DNA primers with particular sequences in a single-stranded DNA molecule that bind to DNA.

In order to perform the polymerase chain reaction, these DNA primres are commonly used to copy pieces. Shellac primers based on oil, latex and pigmented are three different types of primers

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Please help Why did we use biodegradable nanoparticles? Please use The worksheet below and don’t copy and paste from Google thank you

Primer designing: A single-stranded DNA sequence (963 nucleotides) that codes for a hypothetical protein are shown below (lower case shaded blue). 1. Design a pair of forward and reverse primers (~18 nucleotides long each) with EcoRI and BamHI added at 5' and 3' ends, respectively, for the amplification and cloning of this a plasmid with the same restriction sites. gene into GTATCGATAAGCTTGATATCGAATTCatggctaaaggcggagct cccgggttca aagtcgcaat acttggcgct gccggtggcattggccagccccttgcgatgttgatgaagatgaatcctctggtttctgttctacatctatatgatgtagtcaatgcccctggtgtcaccgctgatatta gccacatggacacgggtgctgtggtgcgtggattcttggggcagcagcagctggaggctgcgcttactggcatggatcttattatagtccctgcaggtgttcctcg aaaaccaggaatgacgagggatgatctgttcaaaataaacgcaggaattgtcaagactctgtgtgaagggattgcaaagtgttgtccaagagccattgtcaacctg atcagtaatcctgtgaactccaccgtgcccatcgcagctgaagttttcaagaaggctggaacttatgatccaaagcgacttctgggagttacaatgctcgacgtagt cagagccaatacctttgtggcagaagtattgggtcttgatcctcgggatgttgatgttccagttgttggcggtcatgetggtgtaaccatttgccccttctatctcagg…

show your rationale How many RT-PCR products generated from 13 copies of mRNA (= cDNA) from 33 PCR amplification cycles? What was the original starting number of mRNA molecules if after 36 PCR cycles, the reaction had generated 996,432,412,672 copies?