Biochemistry (Looseleaf)
9th Edition
ISBN: 9781319114800
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Question
Chapter 4, Problem 21P
Interpretation Introduction
Interpretation:
The definition of retrovirus along with its flow of information as compared to an infected cell should be explained.
Concept introduction:
The flow of genetic information depends on the genetic code that is DNA or RNA.
Retrovirus is a type of virus which has RNA as a genetic medium. It uses reverse transcriptase to convert RNA into DNA which is integrated into a host cell.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
need help.
Which of the following are true in regards to the SARS-CoV-2 RNA-dependent RNA polymerase? Select all that apply
It is an enzyme.
It creates RNA polymers
It copies the SARS-Cov-2 genome.
It copies viral RNA that the host machinery then turns into proteins.
It synthesizes DNA polymers.
It breaks down RNA polymers
It breaks down DNA polymers
"alive". Which student do you agree with? Explain your reasoning. (2)
3. Is the virus pictured below a naked virus or envelop virus? How can you tell? (2)
4. What is the function of the protein spikes on a virus? (1)
5. In your own words, describe how a virus multiplies. (6)
hp
SELECT ALL THAT APPLY. Choose the CORAECT statements from the foilowing
Enfuvirtide is a novel antiviral drug that inhibits integrase enzyme
Interfering with DNA synthesis by inhibition of the reverse transcriptase enzyme is a strategy used in the treatment of cancer
Acyclovir inhibits viral DNA synthesis and is used in the treatment of herpes infections
Nevirapine is an antiviral drug that inhibits viral reverse transcriptase enzyme
Chapter 4 Solutions
Biochemistry (Looseleaf)
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Similar questions
- True or False. 1. a.) RNA polymerase decodes mRNA so the ribosome can make proteins. b.) Only coding RNA can interact with the ribosome. c.) The ribosome is composed of both protein and ncRNA. d.)The ncRNA components of the ribosome behave as a ribozyme. Pick one of the FALSE statements from the 4 previous questions and explain why it is incorrect.arrow_forwardmatch.arrow_forwardCentral Dogma Application: Using the basic concept of Process of central dogma provide the following answer in the given DNA sequence on how genetic information flow. IV. Given DNA Sequence: ATCGATCGCGATCGATTACATATGCGCCCCTTTTTCCCGGGAATAATGCTAGCTAGCATGCATCAG Product of Replication: ( Product of Transcription: Product of Translation: {.arrow_forward
- Please ASAP. Thank you.arrow_forward. Explain why the following statement is true: RNA polymerase copies template DNA in the 3’ to 5’ direction.arrow_forwardSelect all that may apply. What is the purpose of incubating the lambda phage/E.coli mixture at room temperature for 20min? Incubation at room temperature inactivates the cI repressor. During incubation at room temperature the lambda phage will enter the lytic cycle. Incubation at room temperature allows for the absorption of lambda phage Incubation at room temperature will allow the lambda phage to remain in the lysogenic cycle.arrow_forward
- Please as comprehensive as possible.arrow_forwardPlease explain why or why notarrow_forwardInhibiting the reverse transcriptase of HIV is a common method for treating HIV infections. a) The HIV reverse transcriptase has two separate functional domains. One domain has polymerase activity. What type of activity do you think the other domain would have?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON