![Biochemistry (Looseleaf)](https://www.bartleby.com/isbn_cover_images/9781319114800/9781319114800_largeCoverImage.gif)
Concept explainers
Interpretation:
The experiments that needs to be designed to determine the factors affecting the DNA double helix structural stability needs to be explained.
Concept introduction:
The stability of a DNA double helical structure depends on the hydrogen bonding between bases and base-stacking interaction between adjacent bases.
The bases present in a single strand of DNA have polar amido, amidino, guanidino and carbonyl groups which form hydrogen bonds with water, but when the double helical structure is formed some of the bond breaks as the bases combine to form inter-base hydrogen bonds. The change in enthalpy, in this case, is due to the difference of energy in the new hydrogen bond formed and old hydrogen bond is broken.
The stability of base stacks of the double helix depends on the DNA sequence. Some sequences are more stable than others, hence the nearest base stack is important to state the stability of the double helical structure.
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 4 Solutions
Biochemistry (Looseleaf)
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardIT IS POSSIBLE TO ESTIMATE THE CONCENTRATION OF SPECIFIC DNA SEQUENCE IN A SOLUTION OF MIXED DNA. Explainarrow_forwardThe Qiagen DNeasy DNA extraction kit is used to extract DNA from a liver cell line for subsequent molecular experiments. (i) (ii) for checking DNA purity using a spectrophotometer. Explain the principle behind this kit in DNA extraction. After the DNA is obtained, the purity of DNA should be determined. Discuss the stepsarrow_forward
- DNA helicases are involved in diverse cellular processes. List four examples of DNA helicases that we discussed in this class and describe their specific activities in the examples you list.arrow_forwardBriefly discuss the applications of k-mer analysis.arrow_forwardYou're purifying some plasmid DNA from a culture of bacteria and you want to know how pure it is. You measure the optical density at 260 m and 280 m and find the ratio is 2.0. You suspect there is RNA contamination in your preparation, so you treat your preparation with RNase. But the ratio is still 2.0. Protein assays tell you there is no protein in your solution, and no other biological molecules absorb light very efficiently at those wavelengths. What's the explanation?arrow_forward
- Ethanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?arrow_forwardYou're purifying some plasmid DNA from a culture of bacteria and you want to know how pure it is. You measure the optical density at 260 nm and 280 nm and find the ratio is 2.0. You suspect there is RNA contamination in your preparation, so you treat your preparation with RNase. But the ratio is still 2.0. Protein assays tell you there is no protein in your solution, and no other biological molecules absorb light very efficiently at those wavelengths. What's the explanation?arrow_forwardIn the Watson-Crick DNA base pairing model, Adenine (A) binds to thymine (T), guanine (G) binds to cytosine (C).Draw the structures of thymine and adenine stabilized by Watson-Crick base pair interaction. Also draw the structure of the amide group of glutamine in an interaction of this T-A pair in a way that maximally satisfies the hydrogen bonding capacity of amide.arrow_forward
- Relate the quantum mechanical theory with the structural state of the DNA double helix. You can use the following questions as a guide:1. How does the electron cloud in a DNA molecule affect the stability and function of its structure? 2. Why do you think the phosphate ribose were used as the backbone of the helical structure? 3. Why are the individual base pairings located in the center of the helix?arrow_forwardGiven the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D).2.2. Describe what are missense mutations and its effects on structure and function using haemoglobin as an examplearrow_forwardBase analysis of DNA from maize (corn) shows it to have 23 mole percent cytosine (moles per 100 moles total nucleotide). What are the percentages of the other three bases?arrow_forward
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)