The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure. Given: The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below: Table 1: The composition of RNA bases in some organisms Organism and the tissue from which RNA is extracted The composition of RNA base (%) Adenine Guanine Cytosine Uracil Rat liver 19.2 28.5 27.5 24.8 Carp muscle 16.4 34.4 31.1 18.1 Yeast 25.1 30.2 20.1 24.6 Rabbit liver 25.1 30.2 20.1 24.6 Cat brain 19.7 26.8 25.8 27.6 Introduction: The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring. The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Question

Want to see the full answer?

Answer 1

Question

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

Draw the most likely secondary structure of the RNA below. Identify each residue in the structure. AGACCGUGUAGGCUAAGCCUAGUCCGUCACGGAAG

To create a DNA:RNA hybrid from a short stretch of DNA with the sequence 5'-GGCTAAGTATGCCTAGTAGC-3', design the corresponding RNA sequence. Indicate the sequence in a 5' to 3' manner. What type of helix (A, B or Z) will this double-stranded nucleic acid form?

If an RNA sample were composed of 20% adenine, what would be the percentage of guanine?

Answer 2

Question

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Answer 6

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Answer 7

Chapter 4, Problem 2Q

Summary Introduction

To analyze:

The ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA), observation of a pattern, and the relation of this pattern to the RNA structure.

Given:

The composition of RNA is different in different organisms. The composition of RNA bases in some organisms is tabulated in Table 1 below:

Table 1: The composition of RNA bases in some organisms

Organism and the tissue from which RNA is extracted The composition of RNA base (%)

Adenine Guanine Cytosine Uracil

Rat liver 19.2 28.5 27.5 24.8

Carp muscle 16.4 34.4 31.1 18.1

Yeast 25.1 30.2 20.1 24.6

Rabbit liver 25.1 30.2 20.1 24.6

Cat brain 19.7 26.8 25.8 27.6

Introduction:

The pyrimidines are heterocyclic compounds, which mean that there are more than two types of atoms in its cyclic structure. The pyrimidines contain a single ring system. The purines are also heterocyclic compounds but they contain a double ring system in which an imidazole ring (a five membered ring having nitrogen and hydrogen atoms) is attached to the pyrimidine ring.

The RNA consists of two types of purines that are, adenine (A) and guanine (G), and two types of pyrimidines that are, uracil (U) and cytosine (C). The RNA contains ribose sugar (presence of –OH at second carbon) instead of deoxyribose sugar (presence of –H at second carbon), and uracil is present as a base instead of thymine. Thymine is also called as the 5-methyl-uracil.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 4.1 - Prob. 1R Ch. 4.1 - Prob. 2R Ch. 4.1 - Prob. 3R Ch. 4.2 - Prob. 1R Ch. 4.2 - Prob. 2R Ch. 4.2 - Prob. 3R Ch. 4.3 - Prob. 1R Ch. 4.3 - Prob. 2R Ch. 4.3 - Prob. 3R Ch. 4.4 - Prob. 1R

Solution Summary: The author analyzes the ratio of purine to pyrimidine for the given set of ribonucleic acid (RNA) and the relation of this pattern to the RNA structure.

Want to see the full answer?

Chapter 4 Solutions

Organism and the tissue from which RNA is extracted	The composition of RNA base (%)
Organism and the tissue from which RNA is extracted		Adenine	Guanine	Cytosine	Uracil
Rat liver	19.2	28.5	27.5	24.8
Carp muscle	16.4	34.4	31.1	18.1
Yeast	25.1	30.2	20.1	24.6
Rabbit liver	25.1	30.2	20.1	24.6
Cat brain	19.7	26.8	25.8	27.6