BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 43P
Interpretation Introduction
Interpretation:
The sequence of the corresponding radiolabeled peptide needs to be determined.
Concept introduction:
A sequence of three DNA or RNA nucleotides is called a Codon. The three-
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
Question 8
Review translation. Match the term and its description. Each term can only be used once.
This site holds the tRNA that carries the growing polypeptide chain
| Choose )
This site holds the tRNA that carries the next amino acid to be
| Choose J
added to the chain
This site is the exit site, where discharged tRNAS leave the
[ Choose )
ribosome
Initiation, elongation and termination
| Choose J
>
Chapter 4 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Be sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forwardLeaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forwardInitiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10arrow_forward
- True or False. Explain. A) At no time during protein synthesis does an amino acid make direct contact with the mRNA being translated. B) Because the two strands of DNA are complementary, the mRNA of a gene can be synthesized using either strand as a template.arrow_forwardComplements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forwardHi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forward
- proteins. Which of the following will tell you whether a protein would be found in the lumen of the ER? A. You run a hydropathy plot an look for hydrophobic peaks that span 20-30 amino acids B. You isolate microsomes and see whether the proteins are inserted into the membrane of the microsome C. You run a hydropathy plot an look for a lack of hydrophobic peaks that span 20-30 amino acids O D. You do in vitro translation of each protein in the presence or absence of microsomes and look to see whether there is a size change in the presence of microsomes.arrow_forwardRNA sequence. ate 3' and 5' ends on BOTH strands ate which strand served as the TEMPLATE strand and which ING strandarrow_forwardA cluster of ribosomes. In a polysome, or polyribosome, the polypeptides associated with which ribosomes will be the longest: a. They will be the same length since the rate of translation is constant. b. Those at the 3'-end3'-end of the mRNA. c. Those at the 5'-end5'-end of the MRNA. d. Those in the middle of the mRNA.arrow_forward
- True or False. Rho-dependent termination of transcription in prokaryotes can take place upon the formation of a strong RNA stern loop in the MRNA just before a run of U residues. True Falsearrow_forwardPolymerase inhibition. Cordycepin inhibits poly(A) synthesis at low concentrations and RNA synthesis at higher concentrations. NH2 H. он Cordycepin (3'-deoxyadenosine) a. What is the basis of inhibition by cordycepin? b. Why is poly(A) synthesis more sensitive than the synthesis of other RNAS to the presence of cordycepin? c. Does cordycepin need to be modified to exert its effect?arrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license