BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
9th Edition
ISBN: 9781319425746
Author: BERG
Publisher: MAC HIGHER
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 4, Problem 18P
Interpretation Introduction
Interpretation:
Why is DNA synthesis performed in 51-31 direction?
Concept introduction:
51 and 31 indicate the number of carbon in DNA sugar backbone. A 51 carbon has phosphate group whereas a 31 carbon has hydroxyl group. The direction of DNA strand is given by this 51 and 31 asymmetry.
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Provide a chemical explanation of why DNA synthesis proceeds in a 5'- to-3' direction.
Backward? Bacteriophage T7 helicase moves along DNA in the 5'-to-
3'5'-to-3' direction. Other helicases have been reported to move in
the 3'-to-5'3'-to-5' direction. Is there any fundamental reason why
you would expect helicases to move in one direction or the other?
Read and analyze the question and choices CAREFULLY; more importantly, ALWAYS CHOOSE the BEST answer.
How are deoxyribonucleoside triphosphates (precursors of daughter DNA strands) and ribonucleoside
triphosphates (precursors of RNA strand) differ from each other?
O A. Deoxyribonucleoside triphosphates have an additional sugar residue at the 2' carbon (carbon number 2) in its
deoxyribose. Meanwhile, an amino acid residue is not attached at the 2' carbon of ribonucleoside triphosphates in its
ribose.
O B. Deoxyribonucleoside triphosphates have an oxygen atom at the 2' carbon (carbon number 2) in its deoxyribose.
Meanwhile, an oxygen atom is not attached at the 2' carbon of ribonucleoside triphosphates in its ribose.
OC Deoxyribonucleoside triphosphates have an amino acid residue at the 2' carbon (carbon number 2) of in
deoxyribose. Meanwhile, an oxygen atom is not attached at the 2' carbon of ribonucleoside triphosphates in its
ribose.
OD. Deoxyribonucleoside triphosphates do not have…
Chapter 4 Solutions
BIOCHEMISTRY W/1 TERM ACHEIVE ACCESS
Ch. 4 - Prob. 1PCh. 4 - Prob. 2PCh. 4 - Prob. 3PCh. 4 - Prob. 4PCh. 4 - Prob. 5PCh. 4 - Prob. 6PCh. 4 - Prob. 7PCh. 4 - Prob. 8PCh. 4 - Prob. 9PCh. 4 - Prob. 10P
Ch. 4 - Prob. 11PCh. 4 - Prob. 12PCh. 4 - Prob. 13PCh. 4 - Prob. 14PCh. 4 - Prob. 15PCh. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - Prob. 18PCh. 4 - Prob. 19PCh. 4 - Prob. 20PCh. 4 - Prob. 21PCh. 4 - Prob. 22PCh. 4 - Prob. 23PCh. 4 - Prob. 24PCh. 4 - Prob. 25PCh. 4 - Prob. 26PCh. 4 - Prob. 27PCh. 4 - Prob. 28PCh. 4 - Prob. 29PCh. 4 - Prob. 30PCh. 4 - Prob. 31PCh. 4 - Prob. 32PCh. 4 - Prob. 33PCh. 4 - Prob. 34PCh. 4 - Prob. 35PCh. 4 - Prob. 36PCh. 4 - Prob. 37PCh. 4 - Prob. 38PCh. 4 - Prob. 39PCh. 4 - Prob. 40PCh. 4 - Prob. 41PCh. 4 - Prob. 42PCh. 4 - Prob. 43PCh. 4 - Prob. 44PCh. 4 - Prob. 45PCh. 4 - Prob. 46PCh. 4 - Prob. 47PCh. 4 - Prob. 48PCh. 4 - Prob. 49PCh. 4 - Prob. 50PCh. 4 - Prob. 51PCh. 4 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Given the active site diagram below, please identify the residue participating in a charge-charge interation. HO OH HN OH 5 ΝΗ *HN ΝΗ OH O Zn²+ 2 4 5 3 1 2 NH 3arrow_forwardSelect TRUE or FALSE for each of the following statements: 1. Only one of the three phosphate groups present in each nucleotide precursor remains present in a DNA polymer. 2. Starch and cellulose are alike in that both contain sugars bonded together in identical ways. 3. The coding strand of DNA is complementary in sequence to the corresponding MRNA. 4. Ribosomal RNA (rRNA) is synthesised by ribosomes in the process of translation. 5. Polyribosomes speed up the rate of transcription.arrow_forwardHydrolysis of the N-glycosyl bond between deoxyribose and a purine base in DNA creates an apurinic (AP) site. An AP site is more thermodynamically destabilizing to a DNA molecule than is a mismatched base pair. Examine the structure of an AP site. HN H₂N N 0 Guanine -O-P-O-CH₂O. H₂N H HN H H H Hod H ofo -0- Guanosine residue (in DNA) -0-CH₂ H H H Apurinic residue H OH Harrow_forward
- Yes or no? for each gene, transcription is initiated at origin of replication. does pre mrna shorter than mrna? Does one thousand microliters less than a milliliter?arrow_forwardDNA is damaged when a base from the DNA chain is removed after an alkylation has occurred. In a depurination reaction, the purine nitrogenous base is displaced from its sugar as shown in this reaction. Draw the mechanism for this reaction and suggest a reason why it occurs so easily. HN' P H2N .N H,O HN° + Pi ОН N- H2N° ОН ОН ОН ОНarrow_forwardIf one strand of DNA has the sequence 5'-C-T-A-G-C-G-T-T-A-3', what sequence would appear opposite it on the other strand? Enter the complementary sequence of letters separated by hyphens. • View Available Hint(s) 3'- 3'-G-A-T-C-G-C-A-A-T-5' -5'arrow_forward
- a. Write the structural formula of GAC, a portion of DNA. Write the complementary strand adjacent to it so that the complementary bases are side by side. Connect the appropriate base pairs. b. Sticking to the convention of writing the nucleotide sequence in the 5'-3' direction, what is the nucleotide sequence of the DNA strand complementary to ATGCACCATGCT?arrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATTarrow_forwardprateins OP (weak bonds) a better source of energy than H,O (strong bonds)? 37. What is the difference between AG, AG, and AG? Which is preferred by biochemists? 38. How can a reaction with a positive AG (like malate-> oxaloacetate) go forward in the cell? 46. Which tautomeric form of each base (A, T, G, and C) is found in standard DNA? What can be the result if the uncommon forms are incorporated into DNA? REarrow_forward
- FIGURE 19.16 Direct repair of dam- aged bases in DNA. (a) The repair of thymine dimers by photolyase. (b) The repair of methylguanine by the transfer of the methyl group to Thymine dimer CH3 SH 06-Methylguanine CH2 ONLINE ANIMATION Н. CH3 Нас. N- н- Н Н N. `NH2 Alkyltransferase alkyltransferase. CONCEPT CHECK: Which of these DNA backbone Alkyltransferase catalyzes the removal of the methyl group onto itself. repair systems is particularly valuable to plants? DNA DNA photolyase cleaves the 2 backbone bonds between the thymine dimer. CH3 Guanine На 'N' CHз Нас. -- н CH2 н Н `NH2 The normal structure of the 2 thymines is restored. The normal structure of guanine is restored. (a) Direct repair of a thymine dimer (b) Direct repair of a methylated base O=arrow_forwardThe hydrophobic effect explains why: O Water regulates pH in the interstitial fluid between eukaryotic cells. O Salt bridges form between oppositely charged histones and DNA in an aqueous environment. Nitrogenous bases are in the interior of the helix, when DNA is in an aqueous environment. Oil forms a homogenous mixture with polar solvents, like acetone.arrow_forwardWhat is the melting temp. of the following double-stranded DNA fragment TCAAAAATCGAATATTTGCTTATCTA AGTTTTTAGCTTATAAACGAATAGATarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
![Text book image](https://www.bartleby.com/isbn_cover_images/9781319114671/9781319114671_smallCoverImage.jpg)
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781464126116/9781464126116_smallCoverImage.gif)
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
![Text book image](https://www.bartleby.com/isbn_cover_images/9781118918401/9781118918401_smallCoverImage.gif)
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305961135/9781305961135_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305577206/9781305577206_smallCoverImage.gif)
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9780134015187/9780134015187_smallCoverImage.gif)
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license