A&P UNITY AND FUNCTION ACCESS
A&P UNITY AND FUNCTION ACCESS
9th Edition
ISBN: 9781264893683
Author: SALADIN
Publisher: MCG
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 4, Problem 4TYC
Summary Introduction

Summary:

The length of an mRNA that coded for 300 amino acid long protein molecule.

Blurred answer
Students have asked these similar questions
What would be the minimum length(approximate number of bases) of an mRNAthat coded for a protein 300 amino acidslong?
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Given the DNA sequence below:        5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’  Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)

Chapter 4 Solutions

A&P UNITY AND FUNCTION ACCESS

Ch. 4.2 - Prob. 5BYGOCh. 4.2 - Describe the roles of RNA polymerase ribosomes,...Ch. 4.2 - What is the difference between genetic...Ch. 4.2 - Summarize the processing of a protein from the...Ch. 4.2 - Prob. 9BYGOCh. 4.2 - Prob. 10BYGOCh. 4.2 - Prob. 1AYLOCh. 4.2 - Prob. 2AYLOCh. 4.2 - The organization of nucleotides into DNA triplets;...Ch. 4.2 - How the genetic code relates mRNA codons to...Ch. 4.2 - The process and outcome of genetic transcription,...Ch. 4.2 - Prob. 6AYLOCh. 4.2 - Prob. 7AYLOCh. 4.2 - Prob. 8AYLOCh. 4.2 - Prob. 9AYLOCh. 4.2 - Prob. 10AYLOCh. 4.3 - Describe the genetic roles of DNA helicase and DNA...Ch. 4.3 - Explain why DNA replication is called...Ch. 4.3 - Define mutation. Explain why some mutations are...Ch. 4.3 - Prob. 14BYGOCh. 4.3 - Prob. 15BYGOCh. 4.3 - Prob. 16BYGOCh. 4.3 - Prob. 1AYLOCh. 4.3 - Semiconservative replication, the enzymes that...Ch. 4.3 - What a mutation is and how a cell detects and...Ch. 4.3 - The four stages of the cell cycle, what occurs in...Ch. 4.3 - Prob. 5AYLOCh. 4.3 - Cytokinesis and how it overlaps but differs from...Ch. 4.3 - Prob. 7AYLOCh. 4.3 - Prob. 8AYLOCh. 4.4 - Why must the carrier of a genetic disease be...Ch. 4.4 - Prob. 18BYGOCh. 4.4 - Prob. 19BYGOCh. 4.4 - Prob. 1AYLOCh. 4.4 - Organization of the karyotype; the number of...Ch. 4.4 - Prob. 3AYLOCh. 4.4 - Prob. 4AYLOCh. 4.4 - Prob. 5AYLOCh. 4.4 - Why a recessive trait can skip a generation, with...Ch. 4.4 - The differences between the genotype, genome, and...Ch. 4.4 - Prob. 8AYLOCh. 4.4 - Prob. 9AYLOCh. 4.4 - Prob. 10AYLOCh. 4.4 - Prob. 11AYLOCh. 4.4 - Prob. 12AYLOCh. 4.4 - Why it cannot be said that dominant alleles are...Ch. 4.4 - Prob. 14AYLOCh. 4.4 - Prob. 15AYLOCh. 4 - Production of more than one phenotypic trait by a...Ch. 4 - When a ribosome reads a codon on mRNA, it must...Ch. 4 - Prob. 3TYRCh. 4 - Two genetically identical strands of a metaphase...Ch. 4 - Prob. 5TYRCh. 4 - Genetic transcription is performed by a....Ch. 4 - Prob. 7TYRCh. 4 - Prob. 8TYRCh. 4 - Semiconservative replication occurs during a....Ch. 4 - Mutagens sometimes cause no harm to cells for all...Ch. 4 - The cytoplasmic division at the end of mitosis is...Ch. 4 - Prob. 12TYRCh. 4 - Prob. 13TYRCh. 4 - Prob. 14TYRCh. 4 - Prob. 15TYRCh. 4 - Prob. 16TYRCh. 4 - Prob. 17TYRCh. 4 - The cytoplasmic granule of RNA and protein that...Ch. 4 - Prob. 19TYRCh. 4 - Prob. 20TYRCh. 4 - Prob. 1BYMVCh. 4 - Prob. 2BYMVCh. 4 - Prob. 3BYMVCh. 4 - Prob. 4BYMVCh. 4 - Prob. 5BYMVCh. 4 - Prob. 6BYMVCh. 4 - Prob. 7BYMVCh. 4 - Prob. 8BYMVCh. 4 - Prob. 9BYMVCh. 4 - Prob. 10BYMVCh. 4 - Prob. 1WWTSCh. 4 - Steroids, carbohydrates, and phospholipids are...Ch. 4 - Prob. 3WWTSCh. 4 - Prob. 4WWTSCh. 4 - Prob. 5WWTSCh. 4 - The law of complementary base pairing describes...Ch. 4 - Prob. 7WWTSCh. 4 - All mutations result m the production of defective...Ch. 4 - Prob. 9WWTSCh. 4 - Prob. 10WWTSCh. 4 - Why world the supercoiled, condensed form of...Ch. 4 - Prob. 2TYCCh. 4 - Given the information in this chapter, present an...Ch. 4 - Prob. 4TYCCh. 4 - Prob. 5TYC
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license