Biochemistry: The Molecular Basis of Life
6th Edition
ISBN: 9780190209896
Author: Trudy McKee, James R. McKee
Publisher: Oxford University Press
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 7Q
Summary Introduction
To review:
The sugar code used for encoding informationis often called “analog” system, while Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)-directed protein synthesis is called “digital” system
Introduction:
Glycome is the total set of sugars and glycans, free or present in a complex form, that a cell or organism produces. It is, thus, the total carbohydrates present in the cell. It is very complex in nature whencompared to the proteome. Its diversity and complexity arises due to its interaction with proteins, which results in the formation of glycoproteins. Glycoproteins are mainly used in modifying the behavior ofa cell in response to an external signal.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences.
Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences.
Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′
In the genetic code, both AAU and AAC code for asparagine. For this reason, the code is said to be
Degenerate
Universal
Ambiguous
Chapter 7 Solutions
Biochemistry: The Molecular Basis of Life
Ch. 7 - Prob. 1QCh. 7 - Prob. 2QCh. 7 - Prob. 3QCh. 7 - Prob. 4QCh. 7 - Prob. 5QCh. 7 - Prob. 6QCh. 7 - Prob. 7QCh. 7 - Prob. 1RQCh. 7 - Prob. 2RQCh. 7 - Prob. 3RQ
Ch. 7 - Prob. 4RQCh. 7 - Prob. 5RQCh. 7 - Prob. 6RQCh. 7 - Prob. 7RQCh. 7 - Prob. 8RQCh. 7 - Prob. 9RQCh. 7 - Prob. 10RQCh. 7 - Prob. 11RQCh. 7 - Prob. 12RQCh. 7 - Prob. 13RQCh. 7 - Prob. 14RQCh. 7 - Prob. 15RQCh. 7 - Prob. 16RQCh. 7 - Prob. 17RQCh. 7 - Prob. 18RQCh. 7 - Prob. 19RQCh. 7 - Prob. 20RQCh. 7 - Prob. 21RQCh. 7 - Prob. 22RQCh. 7 - Prob. 23RQCh. 7 - Prob. 24RQCh. 7 - Prob. 25RQCh. 7 - Prob. 26RQCh. 7 - Prob. 27RQCh. 7 - Prob. 28FBCh. 7 - Prob. 29FBCh. 7 - Prob. 30FBCh. 7 - Prob. 31FBCh. 7 - Prob. 32FBCh. 7 - Prob. 33FBCh. 7 - Prob. 34FBCh. 7 - Prob. 35FBCh. 7 - Prob. 36FBCh. 7 - Prob. 37FBCh. 7 - Prob. 38SACh. 7 - Prob. 39SACh. 7 - Prob. 40SACh. 7 - Prob. 41SACh. 7 - Prob. 42SACh. 7 - Prob. 43TQCh. 7 - Prob. 44TQCh. 7 - Prob. 45TQCh. 7 - Prob. 46TQCh. 7 - Prob. 47TQCh. 7 - Prob. 48TQCh. 7 - Prob. 49TQCh. 7 - Prob. 50TQCh. 7 - Prob. 51TQCh. 7 - Prob. 52TQCh. 7 - Prob. 53TQCh. 7 - Prob. 54TQCh. 7 - Prob. 55TQCh. 7 - Prob. 56TQCh. 7 - Prob. 57TQCh. 7 - Prob. 58TQCh. 7 - Prob. 59TQCh. 7 - Prob. 60TQCh. 7 - Prob. 61TQCh. 7 - Prob. 62TQCh. 7 - Prob. 63TQCh. 7 - Prob. 64TQCh. 7 - Prob. 65TQCh. 7 - Prob. 66TQCh. 7 - Prob. 67TQCh. 7 - Prob. 68TQCh. 7 - Prob. 69TQCh. 7 - Prob. 70TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- List a few exceptions to the genetic code.arrow_forwardMost proteins have more leucine than histidine residues, but more histidine than tryptophan residues. Correlate the number of codons for these three amino acids with this information.arrow_forwardbriefly explain the importance of the degeneracy of the genetic code in the translation process. do not simply define the givenarrow_forward
- Explain the significance of the following statement: The functioning of the aminoacyl-tRNA synthetases is referred to as the second genetic code.arrow_forwardList three categories of posttranslational processingarrow_forwardWhat is meant by the term "sugar code"? What are the challenges in the field of glyco-biology?arrow_forward
- What is the meaning of the statement “The code is redundant but not ambiguous?”.arrow_forwardAbout how many GTps does it take to synthesize a protein 100 amino acids long?arrow_forwardThe fidelity of the genetic code and the transfer of information contained in genes to proteins is crucial to the function of the cellular machinery and the life of the cell. Is the genetic code universal in all cells? What characteristics of the genetic code contribute to its degeneracy? How can changes in the genetic code alter cell function? Share relevant examples, of how the genetic code could be potentially altered and/ or the effect of changes in the code on protein expression. Include a reference.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY