GENETIC ANALYSIS: INTEGRATED - ACCESS
GENETIC ANALYSIS: INTEGRATED - ACCESS
3rd Edition
ISBN: 9780135349298
Author: Sanders
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Textbook Question
Book Icon
Chapter 7, Problem 8P

Figures 1.6 present simplified depictions of nucleotides containing deoxyribose, a nucleotide base, and a phosphate group. Use this simplified method of representation to illustrate the sequence 3' -AGTCGAT- 5' and its complementary partner in a DNA duplex.

a. What kind of bond joins the C to the G within a single strand?

b. What kind of bonds join the C in one strand to the G in the complementary strand?

c. How many phosphodiester bonds are present in this DNA duplex?

d. How many hydrogen bonds are present in this DNA duplex?

Blurred answer
Students have asked these similar questions
The following is diagram of a generalized tetranucleotide. Carbons exist at corners on the shapes and phosphate groups are filled circles. A. Is this a DNA or an RNA Molecule? B. Where is the 3’ end of this tetranucleotide? C. Given that the DNA strand which served as a template for the synthesis of this tetranucleotide was composed of the bases 5’-ACAG-3’, where are the expected bases?
Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragment
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC   Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC   Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence:         Name and explain two different ways in which DNA can be damaged.     Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?

Chapter 7 Solutions

GENETIC ANALYSIS: INTEGRATED - ACCESS

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license