GENETIC ANALYSIS: INTEGRATED - ACCESS
3rd Edition
ISBN: 9780135349298
Author: Sanders
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 16P
Summary Introduction
Introduction:
According to Chargaff’s rule, in DNA of any living organism, the ratio of nitrogen bases i.e. purine and pyrimidine is
In the DNA structure Purine, Adenine (A) is always paired with pyrimidine, Thymine (T) and another purine. In the DNA structure Purine, Guanine (G) is always paired with pyrimidine, Cytosine (C).
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)
The base composition of one of the DNA chains of a DNA double helix contains 18 mol-%A, 35 mol-%T, 26 mol-%C, and 21 mol-%G
(a) What is the base composition of the complementary DNA chain?
(b) Is the total amount of purine bases equal to the total amount of pyrimidine bases for the DNA double helix?
A circular, double-stranded DNA contains 2100 base pairs. The
solution conditions are such that DNA has 10.5 bp/turn.
(a) What is Lo for this DNA?
(b) The DNA is found to have 12 left-handed superhelical turns.
What is the superhelix density o?
Chapter 7 Solutions
GENETIC ANALYSIS: INTEGRATED - ACCESS
Ch. 7 - What results from the experiments of Frederick...Ch. 7 - 7.2 Explain why Avery, MacLeod, and McCarty’s in...Ch. 7 - 7.3 Hershey and Chase selected the bacteriophage...Ch. 7 - 7.4 Explain how the Hershey and Chase experiment...Ch. 7 - 7.5 One strand of a fragment of duplex DNA has the...Ch. 7 - 7.6 The principles of complementary base pairing...Ch. 7 - For the following fragment of DNA, determine the...Ch. 7 - 7.8 Figures present simplified depictions of...Ch. 7 - 7.9 Consider the sequence -ACGCTACGTC-.
What is...Ch. 7 - DNA polymerase III is the main DNA-synthesizing...
Ch. 7 - There is a problem completing the replication of...Ch. 7 - Explain how RNA participates in DNA replication.Ch. 7 - A sample of double-stranded DNA is found to...Ch. 7 - Bacterial DNA polymerase I and DNA polymerase III...Ch. 7 - Diagram a replication fork in bacterial DNA and...Ch. 7 - Prob. 16PCh. 7 - Which of the following equalities is not true for...Ch. 7 - List the order in which the following proteins and...Ch. 7 - Two viral genomes are sequenced, and the following...Ch. 7 - Matthew Meselson and Franklin Stahl demonstrated...Ch. 7 - Raymond Rodriguez and colleagues demonstrated...Ch. 7 - 7.22 Joel Huberman and Arthur Riggs used pulse...Ch. 7 - 7.23 Why do the genomes of eukaryotes, such as...Ch. 7 - Bloom syndrome (OMIM 210900) is an autosomal...Ch. 7 - 7.25 How does rolling circle replication (see...Ch. 7 - Telomeres are found at the ends of eukaryotic...Ch. 7 - A family consisting of a mother (I-1), a father...Ch. 7 - In a dideoxy DNA sequencing experiment, four...Ch. 7 - Prob. 29PCh. 7 - Using an illustration style and labeling similar...Ch. 7 - A PCR reaction begins with one double-stranded...Ch. 7 - Prob. 32PCh. 7 - Prob. 33PCh. 7 - 7.34 A sufficient amount of a small DNA fragment...Ch. 7 - You are participating in a study group preparing...Ch. 7 - Prob. 36PCh. 7 - The following diagram shows the parental strands...Ch. 7 - Go to the OMIM website...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- One of the useful rules of thumb that you may have learned in Biochemistry, is that a 50 g/ml solution of DNA has an absorbance of about 1.0 in a 1 cm cell. A. I have a solution of DNA that has a transmittance of 0.15 when it is placed in a cell with a 200 um pathlength. What is the concentration of DNA in this solution? (in units of g/ml) B. Assume that this DNA is a synthetic oligo containing 25 base pairs, and that the MW of a single base pair has a molecular weight of 330. What is the molar concentration of duplex DNA molecules in the solution? C. What is the Molar absorptivity of DNA in units of L cm (mol base pair) -1 -1arrow_forwardAssume that the molar percentage of thymine in a double stranded DNA is 20. What are the percentages of the four bases (G, C, T, A)? b. The base content of a sample of DNA is as follows: A=31% G=31% T=19% C=19%. What conclusion can be drawn from this information?arrow_forward(a) (b) (c) The figure shown below is the mechanism of a DNA nuclease. The DNA molecule is in blue while the protein residues are in black (M1 and M2 are metal ions, they are irrelevant to this question). 3' Base reaction. M² 5' 00 3' Glu 357 M¹ Draw the structure of the final DNA product for this reaction. Draw a square around the nucleophile and draw a circle around the leaving group in this Does this depict the reaction of an endonuclease or an exonuclease?arrow_forward
- The Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardThe two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure below shows the bonding of thymine and adenine. Each charge shown is +e or - e, and the H-N distance is 0.110 nm. (a) Calculate the net force that thymine exerts on adenine. Is it attractive or repulsive? To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O- H-N and the N-H-N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O-H-N set, the O- exerts a force on both the H+ and the N-, and likewise along the N–H-N set. (b) Calculate the force on the electron in the hydrogen atom, which is 0.0529 nm from the proton. Then compare the strength of the bonding force of the electron in hydrogen with the bonding force of the adenine-thymine molecules (H (H (H)…arrow_forwardWrite the sequence of the complementary DNA strand thatpairs with each of the following DNA base sequences:(a) GGTTAC(b) CCCGAAarrow_forward
- The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10 9 D. In your answers, show how you came up to each result?(a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in micrometer?arrow_forwardif this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)arrow_forwardCalculate the mass in grams of a double helical DNA molecule stretching from the earth to the moon (320,000 km). The mass of the double helix is about 1 x 10-8 g per 1000 nucleotide pairs and each base pair extends 0.34 nm. The human body contains about 0.5 g DNA. What can you say about the progression from double stranded DNA to chromosomes when you consider your answer to (a)?arrow_forward
- Given the following eukaryotic DNA strand, transcribe and translate the DNA into a polypeptide using the 3’ – 5’ strand as the template. You may use drawings, diagrams, colours and annotations to describe how the DNA strand will be synthesized into a functional protein. (32) (KEY: The letters SBMD are “made up” nucleic acids that depict non-coding regions in the DNA, hypothetically S pairs with B and M pairs with D). 5’ - TATAAAAASSMSBMDATGSBDCCMBDBAATBSMDSTGTGTCCTMSBAG – 3’arrow_forwardA solution contains DNA polymerase and the Mg ²+ salts of dATP, dGTP, dCTP, and TTP. The following DNA molecules are added to aliquots of this solution. Which of them would lead to DNA synthesis? (a) A single-stranded closed circle containing 1000 nucleotide units. (b) A double-stranded closed circle containing 1000 nucleotide pairs. (c) A single-stranded closed circle of 1000 nucleotides base-paired to a linear strand of 500 nucleotides with a free 3' -OH terminus. (d) A double-stranded linear molecule of 1000 nucleotide pairs with a free 3’-OH group at each end.arrow_forwardWrite the sequence of the complementary DNA strand that pairs with each of the following DNA base sequences:(a) TTAGCC(b) AGACATarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Macromolecules | Classes and Functions; Author: 2 Minute Classroom;https://www.youtube.com/watch?v=V5hhrDFo8Vk;License: Standard youtube license