Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 8, Problem 14P
Three genes identified in the diagram as A, B and C are transcribed from a region of DNA. The
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’.
2a). Following transcription, what is the total number of codons in the mRNA transcript?
2 b). Where is the start codon located in this mRNA transcript?
2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
Given the following DNA sequence of the template strand for a given gene:
5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3'
Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends).
Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.
Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
The sequence below is of the DNA duplex for a gene in which transcription begins with the nucleotide
highlighted by the arrow. If the upper strand shown is the template strand, write the sequence you expect
for the mRNA transcribed from this gene. Please write 5' to 3'.
5'-[x]-3'
5'-TACGTGACGGTAATACTAGC-3'
3'-ATGCACTGCCATTATGATCG-5'
Chapter 8 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forwardThe following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.arrow_forwardThe following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. Draw or write-out a) the sequence of the primary transcript and b) the mature mRNA resulting from this stretch of DNA.arrow_forward
- The following represent deoxyribonucleotide sequences in the template strand of DNA: Sequence 1: 5′-CTTTTTTGCCAT-3′ Sequence 2: 5′-ACATCAATAACT-3′ Sequence 3: 5′-TACAAGGGTTCT-3′ (a) For each strand, determine the mRNA sequence that would be derived from transcription. (b) Using Figure 12–7, determine the amino acid sequence that is encoded by these mRNAs. (c) For Sequence 1, what is the sequence of the partner DNA strand?arrow_forwardGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.arrow_forwardThe following is a DNA sequence of gene Z. The underlined sequence represents the promoter for gene Z and the underlined and italicized sequence encodes the gene Z ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (bold) a. What are the nucleotides of the mRNA from gene Z?b. What are the amino acids encoded by gene Z? (A codon chart is found on the finalpage)arrow_forward
- The BNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U P с > < A G U UUU UUC Phe UUA UUG CUU CUC CUA CUG L GUU GUC GUA GUG Leu Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala Cys UAA Stop UGA Stop A Trp UAG Stop UGG CAC His CGU J CGC CAA I CGA Gin CAGG CGG AAA 1 AAG Lys UGU UGC AAU Asn AGC} AAC GAC Asp GAA GAGGIU For the toolbar, press ALT+F10 (PC) or ALT+FN+F10 (Mac). BIUS Paragraph V Arial G 1 AGA 1 AGG GGU GGC GGA GGG Arg Ser Arg Gly V DCAG DCA DOA UCAG Third letter 10pt < Av V IX Q ... O WORDS POWERED BY TINYarrow_forwardin the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.arrow_forwardGiven the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forward
- Given the DNA sequence below: 5’-ACATGTGTACAGGCTTTGTCTGAATGGCTT-3’ 3’-TGTACACATGTCCGAAACAGACTTACCGAA-5’ Transcribe the gene. (Write the primary structure of the mRNA that will be produced.)arrow_forwardFor each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acidarrow_forwardComplete the protein synthesis for the partial DNA sequence for a normal FGFR3 gene (TOP) and mutated FGFR3 gene (BOTTOM). Remember, when filling in mRNA, use capital letters only. When filling in amino acids, use three letters, with the first letter capitalized. If you do not use this format, your answer may be marked wrong. DNA CCG TTC GGG GAA ССС MRNA Amino Acid DNA CCG TTC GGG GAA TCC MRNA Amino Acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY