Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
Question
Book Icon
Chapter 8, Problem 15P
Summary Introduction

To analyze:

Four introns labeled A to D are present in eukaryotic gene (Gen-100). Consider that Gen-100 has been isolated and the DNA of the gene (Gen-100) has been denatured. Then it is mixed with polyadenylated mRNAfrom the gene.

a. The R-loop structure, seen with electron microscopy is to be illustrated.

b. The introns are to be labelled.

c. Single stranded or double stranded, intron region is to be determined.

Introduction:

DNA contains coding and non-coding regions called exons and introns respectively. During post-transcriptional modifications of eukaryotic DNA, the introns are spliced out and mature mRNA is synthesized containing only exons. R-looping was first discovered and described in 1976 by Richard. J. Roberts and Philip A. Sharp. R-loop is a three-stranded structure. It is composed of a hybrid of RNA: DNA and the single-stranded non-template DNA. The R-loops are created in the laboratory by hybridization of mature mRNA and double-stranded DNA. The intronicregion of DNA gets spliced out from the mRNA and forms single-stranded structure as they cannot hybridize with the dsDNA.The spliced intronic regions will form the loops between the exons. These R-loops are observed by electron microscopy.

Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+), Chapter 8, Problem 15P

Blurred answer
Students have asked these similar questions
DNA from a eukaryotic gene was isolated, denatured, and hybridized to the mRNA transcribed from the gene; the hybridized structure was then observed with an electron microscope. The adjoining diagram shows the structure that was observed. a. Identify and label the exons and introns in this hybridized structure.
Consider the following gene with their respective introns and exons   5’ – TCATGCATTTTGCGCGGGAAATAGCTCA – 3’ 3’ – AGTACGTAAAACGCGCCCTTTATCGAGT – 5’ Using the bottom as a template strand, create: A. A primary mRNA transcript B. A processed mRNA transcriptC. Highlight where your START and STOP codons are in your processed transcript (if there are any).  D. The resulting protein sequence
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B )  Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid.  Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?

Chapter 8 Solutions

Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)

Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education