![Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)](https://www.bartleby.com/isbn_cover_images/9780135564172/9780135564172_largeCoverImage.gif)
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
3rd Edition
ISBN: 9780135564172
Author: Mark Sanders, John Bowman
Publisher: PEARSON+
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 8, Problem 3P
Answer these questions concerning promoters.
a. What role do promoters play in transcription?
b. What is the common structure of a bacterial promoter with respect to consensus sequences?
c. What consensus sequences are detected in the mammalian
d. Eukaryotic promoters are more variable than bacterial promoters. Explain why.
e. What is the meaning of the term alternative promoter? How does the use of alternative promoters affect transcription?
Expert Solution & Answer
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Students have asked these similar questions
Consider a mutation in -10 BOX promoter consensus sequence (TATAAT) in the prokaryote recA gene where the first T base mutated to G, what outcome(s) are likely?
a.
transcription levels will increase as the GC content would increase
b.
this mutation is silent, so no change in transcription level
c.
transcription levels would decrease because the promoter would be weaker
d.
transcription levels do not depend on the promoter sequence for the gal gene
e.
nothing would happen because the promoter would not change the mRNA sequence
Answer these questions concerning promoters.
a) What role do promoters play in transcription?
b) What is the common structure of bacterial promoter with respect to consensus sequences?
c) Eukaryotic promoters are more variable than bacterial promoters. Why?
d) What is the meaning of the term alternative promoter? How does the use of alternative promoters affect transcription?
The following diagram represents a transcription unit on a DNA molecule. a. Assume that this DNA molecule is from a bacterial cell. Draw the approximate locations of the promoter and terminator for this transcription unit. b. Assume that this DNA molecule is from a eukaryotic cell. Draw the approximate location of an RNA polymerase II promoter.
Chapter 8 Solutions
Pearson eText Genetic Analysis: An Integrated Approach -- Instant Access (Pearson+)
Ch. 8 - Prob. 1PCh. 8 - 8.2 In one to two sentences each, describe the...Ch. 8 - 8.3 Answer these questions concerning...Ch. 8 - 8.4 The diagram below shows a DNA duplex. The...Ch. 8 - The following is a portion of an mRNA sequence:...Ch. 8 - Compare and contrast the properties of DNA...Ch. 8 - The DNA sequences shown below are from the...Ch. 8 - Bacterial and eukaryotic gene transcripts can...Ch. 8 - Describe the two types of transcription...Ch. 8 - What is the role of enhancer sequences in...
Ch. 8 - Prob. 11PCh. 8 - Draw a bacterial promoter and label its consensus...Ch. 8 - For a eukaryotic gene whose transcription require...Ch. 8 - Three genes identified in the diagram as A, B and...Ch. 8 - Prob. 15PCh. 8 - 8.16 The segment of the bacterial gene involved in...Ch. 8 - Prob. 17PCh. 8 - Prob. 18PCh. 8 - 8.19 A DNA fragment from the end of the mouse...Ch. 8 - 8.20 Wild-type E. coli grow best at but can grow...Ch. 8 - A mutant strain of Salmonella bacteria carries a...Ch. 8 - 8.22 The human wild-type allele and a certain...Ch. 8 - Prob. 23PCh. 8 - A full-length eukaryotic gene is inserted into a...Ch. 8 - The accompanying illustration shows a portion of a...Ch. 8 - DNA footprint protection (described in Research...Ch. 8 - Suppose you have a 1-kb segment of cloned DNA that...Ch. 8 - Assume that a mutation affects the gene for each...Ch. 8 - 8.29 The DNA sequence below gives the first base...Ch. 8 - 8.30 Genomic DNA from a mouse is isolated,...Ch. 8 - 8.31 A portion of a human gene is isolated from...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Compare the control of gene regulation in eukaryotes and prokaryotes at the level of initiation of transcription. How do the regulatory mechanisms work? What are the similarities and differences in these two types of organisms in terms of the specific components of the regulatory mechanisms? Address how the differences or similarities relate to the biological context of the control of gene expression.arrow_forwardA bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT Group of answer choices 1.The mutation would inhibit the promoter thereby inhibiting transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would move the promoter away from consensus and reduce the level of transcription 4.The mutation would bind the promoter to the consensus and produce normal levels of transcriptionarrow_forwardYour investors are concerned that the GasP protein might not be sufficiently produced under normal laboratory conditions. They suggest controlling the transcription of the gasP gene using a chemical that will “trigger” its transcription. a. What type of promoter could be used? b. What chemical will you use to control transcription? c. How does this method of control work?arrow_forward
- Comparing the -10 regions of two E. coli promoters which have identical -35 regions revealed the sequence TATAAT for the first and GATACT for the second one. Why does the first promoter cause a higher transcription rate than the second one? a. The transcription rate from the first promoter will be higher, because RNA polymerase will bind TATAAT with a higher affinity than GATACT. b. It will be higher, because formation of the open promoter complex is more easily achieved with TATAAT than with GATACT. c. It will be higher, because TATAAT of the -10 region is transcribed into UAUAAU, which forms fewer hydrogen bonds with the template strand than GAUACU. d. a and b, but not c e. a, b, and carrow_forwardThere are similarities and differences during regulation of gene expression in both prokaryotes and eukaryotes. Promoters, transcription factors and RNA polymerase are essential elements in transcription but their properties and function may differ.a) Predict the outcome or consequences of mRNA transcription by RNA polymerase II in eukaryote without the presence of transcription factors (TF).arrow_forwardA bacterial species has a hypothetical sigma promoter that has the following sequence: TTGGCA - 18 bases - TATAAT What change in the level of transcription would there be if the sequence was mutated to: TTCGCA -18 bases -TATAAT 1.The mutation would move the promoter away from consensus and reduce the level of transcription 2.No change the consensus TATAAT sequence in the same. 3.The mutation would bind the promoter to the consensus and produce normal levels of transcription 4.The mutation would inhibit the promoter thereby inhibiting transcriptionarrow_forward
- 1)A. how do you read a sequence of DNA (template or non-template strand) to convert it an mRNA sequence and to a protein? B.How does chromatin remodeling regulate gene transcription? C. What are the major differences between gene expression in bacteria and eukaryotes D. How are non-coding regions involved in gene transcription? E. Explain how eukaryotic genes sometimes produce multiple protein products?arrow_forwardPredict the state of transcription activation in the following scenarios: A. Regulated as usual B. Higher levels of transcription C. Lower levers of transcription Everything in the system is intact except activators can no longer bind to chromatin modifiers Everything in the system is intact except there are overly active histone deacetylases Everything in the system is intact except heterochromatin is constantly shifted to the form of euchromatin Everything in the system is intact except the main coactivator Mediator no longer binds to RNA Polymerase IIarrow_forward. Another class of suppressor mutations, not describedin the chapter, are mutations that suppress missensemutations.a. Why would bacterial strains carrying such missense suppressor mutations generally grow moreslowly than strains carrying nonsense suppressormutations?b. What other kinds of mutations can you imagine ingenes encoding components needed for gene expression that would suppress a missense mutationin a protein-coding gene?arrow_forward
- Consider a gene being transcribed at a constant rate k1 and being degraded with first order kinetics with a rate constant of k2. a. Write the chemical reaction for transcriptionb. Derive the instantaneous concentration of the mRNA within the cell. Explicitly list all assumptions.arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forwardThere is Hyaluronic acid synthesis occuring in Group X Strep and it is controlled by an operon with 3 genes, called hasXYZ. Based on the 3-line diagram model, a. How many ribosome binding sites are there for the protein? b. How many promoters are there for the genes? c. How many start codons are there for the protein? d. How many RNA Polymerase binding locations are there for the genes? e. How many proteins will be fully functional? f. How many mRNA strands are made?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license