Concept explainers
The following diagram describes the mRNA sequence of part of the A gene and the beginning of the B gene of phage ϕX174. In this phage, some genes are read in overlapping reading frames. For example, the code for the A gene is used for part of the B gene, but the reading frame is displaced by one base. Shown here is the single mRNA with the codons for proteins A and B indicated.
aa# 5 6 7 8 9 10 11 12 13 14 15 16
A AlaLysGluTrpAsnAsnSerLeuLysThrLysLeu
mRNA GCUAAAGAAUGGAACAACUCACUAAAAACCAAGCUG
B MetGluGlnLeuThrLysAsnGlnAla
aa# 1 2 3 4 5 6 7 8 9
Given the following amino acid (aa) changes, indicate the base change that occurred in the mRNA and the consequences for the other protein sequence.
a. | Asn at position 10 in protein A is changed to Tyr. |
b. | Leu at position 12 in protein A is changed to Pro. |
c. | Gln at position 8 in protein B is changed to Leu. |
d. | The occurrence of overlapping reading frames is very rare in nature. When it does occur, the extent of the overlap is not very long. Why do you think this is the case? |
![Check Mark](/static/check-mark.png)
Want to see the full answer?
Check out a sample textbook solution![Blurred answer](/static/blurred-answer.jpg)
Chapter 8 Solutions
ND STONY BROOK UNIVERSITY LOOSELEAF GENETICS: FROM GENES TO GENOMES
- Figure 2 is a schematic drawing of ABC gene, which encodes ABC protein. Transeriptional terminator Promoter Intron 1 Intron 2 1 100 s100 base pairs 1100 2100 3100 4100 Positions 200-203 = Start codon Positions 4800-4802 = Stop codon Figure 2. (i) The transcript first produced by ABC gene would be approximately how many nucleotides long?arrow_forwardImagine you are going to label a gene associated with apoptosis in Symbiodiniaceae with a Yellow Fluorescent Protein (YFP). To generate the YFP, you know the pre-MRNA looks as follows: Unspliced YFP premature mRNA Сap 5' UTR Exon 1 Intron Exon 2 Intron Exon 3 3' UTR Poly-A tail If Exon 2 is also required for mRNA stability, what can be predicted from the possible spliced alternative isoforms formed? One of the isoforms will not have a poly-A tail O The alternative splicing of YFP pre-MRNA prevents 5'-capping The MRNA isoform without Exon 2 will be degraded faster than the other isoform Exon 2 will be added to isoform B later to correct the mistake in splicing The protein translated from one of the mRNA isoforms will possess an additional functional domainarrow_forwardBelow is a diagram of an Oscar Miller (Christmas tree) spread. Which of the following is true? Wy O a. this represented the first example in eukaryotes in which translation was visualized with the electron microscope O b. each "Christmas tree" represents the transcription of a single type of rRNA (i.e. 28S or 18S or 5.8S) O c. as drawn, transcription is proceeding from left to right Od.three nucleolar organizer regions are shown 1arrow_forward
- The bacteriophage genome consists primarily of genes encodingproteins that make up the head, collar and tail, and tail fibers When these genes are transcribed following phage infection, howare these proteins synthesized, since the phage genome lacksgenes essential to ribosome structure?arrow_forward5' 3' ORF1 ORF2 ORF3 ORF4 ORF5 1. Above are pictured 2 operons, one that includes ORF1 and OFR2 and is transcribed using the top DNA strand as the template, and the other includes ORF3, ORF4, and ORF5 and is transcribed using the bottom DNA strand as the template. 3' 5' a) Complete this diagram by using arrows (4) to indicate the position and direction of the promoter(s). It doesn't matter if you draw the arrows above or below the ORFS as long as they are pointing the right way. b) Underline and label with "RBS" the ribosome binding site(s). c) How many different RNA molecules will be made from this region of DNA? d) How many different proteins will be made from this region of DNA? e) How many promoters are found in this region of DNA? f) How many stop codons are found in this region of DNA? g) What assay would you use to investigate the protein accumulation of these ORFs?arrow_forwardGiven the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?arrow_forward
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardThe following gene sequence of nucleotides is found on the template (non-coding) strand of a molecule of DNA from a bacterial cell. The promoter of the gene is highlighted in bold letters and the +1 is underlined. Use the genetic code at the end of this packet to answer the following questions. 3'-AGGCATATTACGATGCCGGTACTTGATGATGACGGACCCATTATAGGACATATG-5' a) What is the sequence of the mRNA strand that will be transcribed from this piece of DNA? Indicate which is the 5’ and which is the 3’ end of the mRNA. b) What is the amino acid sequence that will be translated from this piece of DNAarrow_forwardShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. = exons Transcription termination site (also poly A site) = introns Promoter Start of transcription 3' 5'. TAA ATG 50 TAC 130 222 850 126 132 90 ATT 5' 3 QUESTION 3: What is the length in nucleotides of the mature, processed B-globin mRNA? A.620 B.980 C.438 D.1600arrow_forward
- M13 is a filamentous phage that infects the bacterium Escherichia coli. Infection with M13 is not lethal. However, the infection causes turbid plaques in E. coli because infected bacteria grow slower than the surrounding uninfected bacteria. This phage has been engineered to act as a vector system. Explain how the amplification of gene of interest works in this phage with illustration.arrow_forwardIn what ways does the double helix explain the essential properties of a gene? What are Chargaff’s rules? Phage T2 is estimated to consist of about 200,000 deoxyribonucleotides pairs. Give the length in micrometer of its DNA complement.arrow_forwardShown below is the genomic structure of the human B-globin gene. The numbers within the boxes indicate the length in nucleotides of each region. = exons = introns Transcription termination site (also poly A site) Promoter Start of transcription 3' 5'. ТАА ATG 50 TÁC 132 |ATT 90 130 222 850 126 3 5' QUESTION 2: What is the length in nucleotides of the primary or B-globin pre-mRNA? A.620 B.980 C.438 D.1600arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
![Text book image](https://www.bartleby.com/isbn_cover_images/9781305251052/9781305251052_smallCoverImage.gif)