Genetic Analysis: An Integrated Approach (3rd Edition)
Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
bartleby

Concept explainers

bartleby

Videos

Question
Book Icon
Chapter 9, Problem 23P
Summary Introduction

To analyze:

The amino acid sequence of a segment of a polypeptide is

N-Cys-Pro-Ala-Met-Gly-His-Lys-C

a. Describe the mRNA order encoding this polypeptide fragment? Use N to denote any nucleotide, Pu to represent purine, and Py to denote a pyrimidine. Also tag 5' and 3' ends of mRNA.

b. Determine the DNA template and coding strand orders corresponding to mRNA. Use the N, Pu, and Py signs as placeholders.

Introduction:

Genetic information of DNA is encoded in a tri-nucleotide code known as codons. Codons have specific characteristics- all the codons specify amino acids; there is one start codon and three stop codons also known as nonsense codons. The beginning and ending of the translation process requires specific codons. The Codons are present on mRNA and are read during translation from 5'-3'. These genetic codes are universal.

Blurred answer
Students have asked these similar questions
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
Using the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.
A fragment of a polypeptide, Met-Thr-Ile-Ser-Asp-Ile is encoded by the following sequence of DNA:Strand A - TACGATGACGATAAGCGACATAGC - Strand B - ATGCTACTGCTATTCGCTGTATCG -Which is the transcribed (template) strand? Write the sequence of the resulting mRNA transcript. Add labels to the strands above to show the 3’ and 5’ ends.

Chapter 9 Solutions

Genetic Analysis: An Integrated Approach (3rd Edition)

Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY