Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 9, Problem 40P
for each of the following
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
For each codon, provide the anticodon and the three-letter abbreviation of the amino acid for which it codes. Consult the codon
table as needed.
5'-AUU-3'
anticodon: 3'-
-5'
amino acid:
5' -UCU-3'
anticodon: 3'-
-5'
amino acid:
5' -CAG-3'
anticodon: 3'-
-5'
amino acid:
Given the following codons and their corresponding amino acids:
UUU-Phenylalanine
GAA- Glutamate
CAA- Glutamine
AAU- Asparagine
AAC- Asn
AAA- Lysine
UCU- Serine
GGA-Glycine
ACC-Threonine
AUG- Met/ START
codon
CCU- Proline
GUU- Valine
UAU-Tyrosine
UAA- STOP
AGG- Arginine
AUU- Isoleucine
CAU- Histidine
GCU- Alanine
UGU-Cysteir
GAU-Asparti
CUA-Leucine
UGG-Tryptol
CGU-Arginin
Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe-
leu. Include what should come before and after this short message. Don't leave any
spaces between the letters.
Box 2: Show the tRNA anticodon sequence that would line up with the mRNA
strand from Box 1. Don't leave any spaces between the letters.
Box 3 & 4: Show the DNA base sequence that would be found in the DNA double
helix which carries the gene for this peptide. Give the coding strand sequence in Box
3 and template strand sequence in Box 4. Don't leave any spaces between the
letters.
Box 5: What if there was a frameshift at leucine…
A tRNA has an anticodon sequence 3′– GGU–5′. Identify the amino acidit is carrying?
Chapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 9 - 9.1 Some proteins are composed of two or more...Ch. 9 - In the experiments that deciphered the genetic...Ch. 9 - 9.3 Several lines of experimental evidence pointed...Ch. 9 - Outline the events that occur during initiation of...Ch. 9 - 9.5 A portion of a DNA template strand has the...Ch. 9 - Describe three features of tRNA molecules that...Ch. 9 - Prob. 7PCh. 9 - For each of the anticodon sequences given in the...Ch. 9 - What is the role of codons UAA, UGA and UAG in...Ch. 9 - Compare and contrast the composition and structure...
Ch. 9 - Consider translation of the following mRNA...Ch. 9 - Prob. 12PCh. 9 - Third-base wobble allows some tRNAs to recognize...Ch. 9 - The genetic code contains 61 codons to specify the...Ch. 9 - 9.15 The three major forms of (,, and ) interact...Ch. 9 - The accompanying figure contains sufficient...Ch. 9 - 9.17 The line below represents a mature eukaryotic...Ch. 9 - 9.18. After completing Problem, carefully draw a...Ch. 9 - 9.19 Define and describe the differences in the...Ch. 9 - 9.20. Describe the roles and relationships...Ch. 9 - 9.21 In an experiment to decipher the genetic...Ch. 9 - Identify and describe the steps that lead to the...Ch. 9 - Prob. 23PCh. 9 - Har Gobind Khorana and his colleagues performed...Ch. 9 - 9.25 An experiment by Khorana and his colleagues...Ch. 9 - Prob. 26PCh. 9 - 9.27 The mature transcribed from the human gene is...Ch. 9 - Prob. 28PCh. 9 - Prob. 29PCh. 9 - Prob. 30PCh. 9 - 9.31 A portion of the coding strand of for a gene...Ch. 9 - A eukaryotic mRNA has the following sequence. The...Ch. 9 - Diagram a eukaryotic gene containing three exons...Ch. 9 - Prob. 34PCh. 9 - 9.35 Table lists and gene sequences for or ...Ch. 9 - Prob. 36PCh. 9 - In terms of the polycistronic composition of mRNAs...Ch. 9 - Prob. 38PCh. 9 - 9.39 Answer the following questions about the...Ch. 9 - 9.40 for each of the following anticodon...Ch. 9 - Prob. 41PCh. 9 - Prob. 42P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-arrow_forwardif the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the tRNA-Leu? 5'-CUG-3' 3'-GAC-5' 3'-CUG-5' 5'-GAC-3'arrow_forwardA tRNA in E. coli charged with His (histidine) would have the anticodon: 5'-CAU-3' 5'-GUG-3' 5'-GGG-3' 5'-CAC-3' 5'-UAC-3'arrow_forward
- Given the following Wild Type and Mutated DNA sequences: 1.) Identify where the base pair change occurs ( what letter changed?) 2.) For BOTH sequences, write the mRNA strands, define the codon regions and amino acid sequences. 3.) Describe what kind of mutation has occurred (missense, nonsense, or silent), and what effect this may have on the protein. Wild Type DNA Sequence: 3' - AGGCTCGCCTGT - 5' Mutated DNA Sequence: 3' - AGTCTCGCCTGT - 5'arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forwardTranslate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’arrow_forward
- A series of tRNAs have the following anticodons. Consider the wobble rules listed in Table and give all possible codons with which each tRNA can pair. Q. 5′ –AAG–3′arrow_forwardTranslate the RNA codons using the given genetic code 5' A-U-C-G-A-C-G-A-U-C-C-G-A-U-C-G-A-U 3'arrow_forwardA tRNA has an anticodon sequence 3′–GGU–5′. What amino acid does it carry?arrow_forward
- Describe the structural and sequence elements that are common to all tRNA molecules, addressing the function of each of the elements. What forces stabilize the tRNAs' structural features?arrow_forwardUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.arrow_forwardGiven the following mRNA and amino acids, construct a polypeptide from this tRNA strand. tRNA UAA CCA UUA UAA mRNA Amino Acids AUU = isoleucine AAU = asparginine GGU = glycine GUC = valine GAG = glutamic acidarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology Today and Tomorrow without Physiology (Mi...BiologyISBN:9781305117396Author:Cecie Starr, Christine Evers, Lisa StarrPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology Today and Tomorrow without Physiology (Mi...
Biology
ISBN:9781305117396
Author:Cecie Starr, Christine Evers, Lisa Starr
Publisher:Cengage Learning
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY