Concept explainers
Diagram a eukaryotic gene containing three exons and two introns, the
the
the
the
the start codon sequence
a stop codon sequence
a codon sequence for the amino acids
Want to see the full answer?
Check out a sample textbook solutionChapter 9 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:arrow_forwardBriefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNAarrow_forwardA segment of mRNA produced by the normal order of DNA nucleotides and the corresponding amino acid chain are given below: mRNA segment: GCC UAC AAU GCG Amino acid chain: Ala-Tyr-Asn-Ala Knowing that insertion mutations shift the triplets by one base, if an insertion mutation adds a U to the beginning of that mRNA segment, what will be the new triplet/codon grouping and the new amino acid chain? Group of answer choices a. U GCC UAC AAU GCG; Ala-Tyr-Asn-Ala b. UCC UAC AAU GCG; Ser-Leu-Gln-Cys c. UGC CUA CAA UGC G; Cys-Leu-Gln-Cys d. UGC CUA CAA UGC G; Ala-Tyr-Asn-Ala e. UGCC UAC AAU GCG; Cys-Tyr-Asn-Alaarrow_forward
- Translation is the process by which the sets of 3 bases (codons) of the mRNA are read to specify the sequence of amino acids for the protein to be produced. Using the genetic code data provided, find the sequence of amino acids that would correspond to the MRNA codons shown. Codons 1 3 MRNA A UGUGGAUC CGAG UCACG Amino acid SECOND LETTER A U UUU Phenylalanine UCU UCC Serine (S) UAU Tyrosine (Y) UAC TAA stop codon UAG stop codon UGU Cysteine (C) UGC TỮA Leucine (L) TGA stop codon UGG Tryptophan (W) F UCA UUG UCG I H CUU CCU CAU Histidine (H) R CGU CỨC Leucine (L) CỦA CCC Proline (P) ССА CCG CGC Arginine (R) CGA CAC "CAA Glutamine CAG (Q CUG CGG G D A AUU L AUC Isoleucine (1) AAU Asparagine AAC (N) ÄÄÄ Lysine (K) AGU Senine (S) ACU ACC Threonine ACA (T) AGC E AUA AGA Arginine (R) E ACG T AUG stat codon (M) AAG AGG TG GƯỮ GAU Apartic acid GAC (D) "GAÄ Glutamic acid GCU GGU GUC Valine (V) GUA GGC Glycine (0) GCC Alanine (A) CE GCA GGA R GUG GCG GGG GAG (E) The start codonencodes the amino…arrow_forwardMatch the term with its definition comparing genomic DNA, mRNA, and proteins. You may only use each option ONCE. where transcription starts. where translation ends a chemical group that indicates the first nucleotide that was added to the mRNA a chemical group that indicates the first amino acid that was added to the polypeptide a DNA sequence that is neither transcribed nor translated a non-protein coding region upstream of the start codon in the mRNA promoter complimentary base-pairs with the codon amino-terminus a DNA sequence that is transcribed, but not intron translated [Choose ] stop codon +1 site tRNA 5-prime UTR start codon exon 5-prime triphosphate promoter amino-terminus 5-prime triphosphate stop codonarrow_forwardThe following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase letters introns. Draw the pre- mRNA, the mature mRNA and translate the codons using the genetic code to form the protein. Identify the 5’UTR and 3UTR 5’- AGGAAATGAAATGCCAgaattgccggatgacGGTCAGCaatcgaGCACATTTGTGATTTACCGT-3’arrow_forward
- Which of these molecules has multiple partial charges and thus is most soluble in water? B H HHH HHH ABCD or E CH H CHOH D CH OH A cell is specialized in producing oil and steroid hormone. Which structure would be found in large r cell? O vacuoles O peroxisome O rough endoplasmic reticulum O smooth endoplasmic reticulum The oxygen released from photosynthesis results from: Reduction of NADP* to NADPH Chemiosmosis Oxidation of water Photophosphorylationarrow_forwardThe following DNA sequence occurs as the template strand: 3’ – TACGGGGATCAGATTATC – 5’ DNA template What single nucleotide deletion within the DNA sequence would cause a frame shift and a premature STOP codon? Write down the sequence of the New DNA template after deletion of the single nucleotide and also that of the New mRNA transcript, and specify the 5’ and 3’ ends of both the template and the mRNA transcript. Highlight the premature stop codon in the mRNA transcript.arrow_forwardA mRNA sequence is shown below. Note that the coding strand of DNA has the same sequence as the mRNA, except that there are U’s in the mRNA where there are T’s in the DNA. The first triplet of nucleotides AAU (underlined) is in frame for coding, and encodes Asparagine. 45 50 55 60 65 5’—A A C G A A U C G U C G C C A A C U A A G A G –-3’ Which of the following DNA mutations is almost certain to result in a shorter than normal protein? at position 56 a change from G to C an insertion of a G after the G at position 56 inversion of region 56-59 (G C C A) an delete the C at position 52 None of the above.arrow_forward
- Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into mRNA and then translate it into the polypeptide. Give the polypeptide sequence in the following form: Met-Thr-Trp-Tyr-Val etc. 5' ACCGAAGGACTTATGGAGCGCTCATGATTTGCT 3'arrow_forwardThe mass of mRNA that has copied a segment of DNA is 36,000 units, the mRNA is placed in the ribosome and represents 60% of it. Determine the mass of the protein encoded by the gene, if the mass of the amino acid is 110 and the mass of the nucleotide is 300.arrow_forwardFor the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'arrow_forward
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage LearningBiology (MindTap Course List)BiologyISBN:9781337392938Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. BergPublisher:Cengage Learning