2. The oskar MRNA is localized in a pre-cellular embryo for future tail development (see Figure A below). Posterior pole Anterior pole (future head) |(future tail) oskar MRNA Figure A Figure B
Q: geneticist happens upon a gene in humans that is not functional and is not currently being expressed
A: Pseudogenes are those which are present in the genome till now but do not perform any function.
Q: The diagram shows part of a pre-mRNA molecule. A G part X (a) (i) Name the two substances that make…
A: Within the cells two types of nucleic acids are found, that are DNA and RNA. They both composed of…
Q: 4. Which mRNA sequence complements the DNA sequence below? (LS1-1)
A: DNA is a polynucleotide strand. DNA is transcribed into RNA and RNA is translated into proteins.…
Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…
A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…
Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…
A: The protein synthesis occurs in cytoplasm by the process of translation.
Q: Although DNA gets all the glory, it’s actually RNA that does most of the work when cells produce…
A: In species, gene expression is a vital and essential process that helps to produce proteins by using…
Q: At fertilization, a sperm contributes a. a diploid nucleus. b. mRNAs. c. a centrosome.…
A: At the time of fertilization the mail contributes haploid sperm and the female contribute ova…
Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…
A: Living cells use a collection of rules called the genetic code to translate information found in…
Q: 1. Determine what is being meant by each statements: a. It describes mRNA that results in a single…
A:
Q: 20. Fill in this table with the effects that this mutation would have on mRNA and protein sequence…
A: Gene mutations are rare and random changes in DNA sequence which result in alteration of polypeptide…
Q: 2. Given the mRNA for a protein: 5'-CCGAACGAUGGGCUAUCCCUAACCGUUU -- 3' Write the amino acid sequence…
A: The nucleotide sequence in mRNA is translated to an amino acid by rules of genetic code. A codon…
Q: 8. Which of the following best describes the messenger RNA (MRNA) molecules found in prokaryotes? A.…
A: Disclaimer : Since you have asked multiple question, we will solve the first question for you. If…
Q: 5. You find a mutant with a 10-bp insertion between the (+1) and the upstream promotor sequences.…
A: The transcription is the process of the mRNA formation from gene or DNA sequence. The mRNA so formed…
Q: 8. Label each figure with what TYPE OF CELL is undergoing gene expression: Nuclear membrane DNA…
A: Gene expression is a process in which first transcription occurs that is formation of RNA occurs…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. What are the amino acids translated from the resulting mRNA?
A: The process of transcription occurs only in one strand of the double-stranded DNA. This strand is…
Q: 1. What would be the amino acid sequence encoded by the MRNA 5'CCAUGACGUCGGAUCAAUGAGC 3' 2. If the…
A: DNA replication is the process in whichbbhvgvhghhccvfgcbgvh
Q: 4. In the graph shown below, the dashed line shows the level of MRNA for a certain protein, Prot6,…
A: Anterior-posterior axis is defined by a line that runs from the head or mouth of an organism to the…
Q: List 4 proteins involved in either Capping or tailing mRNA and tell whata each one does.
A: Answer: TRANSCRIPTION = It is the process of transcribing DNA in to mRNA , it is the second step of…
Q: An mRNA has a sequence 3'-AAAUUACUCGAAAUUGCGUGUAGU5'. a) What would be the DNA, t-RNA and amino acid…
A: Points to know : The fundamental process of protein synthesis is the formation of peptide bond…
Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…
A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…
Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…
A: mRNA is made from DNA by the process of Transcription.
Q: Multiple 3′ cleavage sites result in a. multiple genes of different lengths. b. multiple pre-mRNAs…
A: Multiple 3' cleavage sites produce different length of RNA transcript as they contain potential…
Q: Build" the mRNA molecule matching the RNA nucleotides to the DNA nucleotides properly, letter by…
A: The process of RNA synthesis with the help of template strand of DNA is called transcription. It is…
Q: 3. Below is part of the DNA genetic code for six amino acids. TTT AAA Codes for phenylalanine САА…
A:
Q: 9. A gene being expressed has the following partial DNA sequence: TACCAACCTACA. What would be the…
A: Here I will provide you mRNA sequence as well as amino acids sequences of the given DNA sequences.
Q: You saw this figure many times during the WC1 group work. To get from the biomacromolecule(s)…
A: Biomacromolecules are the complex polymers of different monomer units (simple). In a human body,…
Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Promoter sequence is present in the DNA at the upstream of regulatory gene.
Q: 6. In the following graph, the dashed line shows the level of mRNA for a certain protein, Prot6, at…
A: The dashed line in the graph shows the level of mRNA for protein, Prot6 at various positions along…
Q: hypothetical protein is 250 amino acids long how many nucleotides are in the code and sequence of…
A: A hypothetical protein is 250 amino acids. Each amino acid residue in a polypeptide chain was coded…
Q: 1. What is RNA? And, how is RNA modified? 2. What are the 3 major steps involved in mRNA…
A: Ribonucleic acid is a molecule similar to DNA. Unlike DNA, RNA is single-stranded.
Q: 3. How do we know that expression of the information encoded in DNA involves an RNA intermediate?
A: DNA or Deoxyribonucleic acid is the genetic material found in all living organisms. DNA is a double…
Q: 12) Which of the following processes occurs during transcription? A) DNA is replicated B) RNA is…
A: The information for the production of functional proteins are stored in segments of DNA called…
Q: What would the sequence of the immature mRNA be? Place the sequence of ALL the transcript that would…
A: Some genes do not synthesize protein by utilising the entire DNA sequence. Introns are non-coding…
Q: 1. Given the MRNA: 5'AUGCAUGACGAUCUCGUCGCG...3' a. Use the genetic code to predict the amino acid…
A: 1. The messenger RNA (mRNA) is produced by the process of transcription from a double-stranded DNA…
Q: discuss how pre mRNA is formed in the nucleus and the RNA processing that happen to form a matured…
A: When an RNA transcript is first made in a eukaryotic cellular, it's far taken into consideration a…
Q: A gene with the following DNA sequence is transcribed and translated: 5’ TAGCTACGGAAAGCGTACACGGACT…
A: Transcription is the process of the formation of RNA from the DNA template strand.
Q: 1) Assuming that all the appropriate accessory proteins (switches) and RNA polymerase is presence,…
A: Gene expression allows the cell to respond to various environments. Transcripted DNA (mRNA) may have…
Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…
A: DNA => Transcription => mRNA => Translation => Protein. Given : Non-template strand…
Q: 3. Write down the corresponding amino acids sequence for each mRNA sequence. Use the codon chart in…
A: Question 3 A) TAC CTA GCG CAC ATG TAG GTG GGC AAA GTT m-RNA sequence: AUG GAU CGC GUG UAC AUC CAC…
Q: 1. Bradykinin peptide: a) The sequence of the gene that encoded it, indicating with different…
A: Note- As per guidelines, we are author to answer only first-three sub parts of first question only.…
Q: 3.explain why the following statement is false. "Interaction of specific transcription factors and…
A: Note: Since you have posted multiple independent questions in the same request, we will solve the…
Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…
A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…
Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…
A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…
Q: 2. Write the base sequence of the hnRNA formed by transcription of the following DNA base sequence.…
A: hnRNA is also called as the heteronuclear RNA. Its synthesis is catalyzed by RNA polymerase II.…
Q: 2. įmagine that you and your colleagues are working in a lab to develop a protein synthesis system…
A: The prokaryotes have a polycistronic mRNA while the eukaryotes have a monocistronic mRNA. The mRNA…
Q: In a fly egg, the nurse cells are killed before they can produce bicoid mRNA. What will happen?…
A: The development of Drosophila is an important event as Drosophila is utilized as a model organism…
Q: Two cells use the same segment of DNA to produce two different proteins. The MRNA transcribed by…
A: Given: Two cells use the same segment of DNA to produce two different proteins. The mRNA transcribed…
Q: How would the artificial mRNA5′. . . GUGUGUGU . . . 3′be read according to each of the following…
A: In molecular biology, a reading frame refers to a method of separating the nucleotides sequence…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. What is RNA? And, how is RNA modified? 2. What are the 3 major steps involved in mRNA processing? Explain each step.3. Why is RNA processing important in development? Explain.2. a. You want to create a genetic construct that will express GFP in Drosophila. In addition to the GFPcoding sequence, what DNA element(s) must youinclude in order to express this protein in flies if theconstruct were integrated into the Drosophila genome? Where should such DNA element(s) be located? How would you ensure that GFP is expressedonly in certain tissues of the fly, such as the wing?b. Suppose you insert the GFP coding region plus allof the DNA elements required by the answer to part(a)—except the enhancer—between inverted repeatsfound at the ends of a particular transposable element.Because all of the DNA sequences located betweenthese inverted repeats can move from place to placein the Drosophila genome, you can generate manydifferent fly strains, each with the construct integrated at a different genomic location. You now examine animals from each strain for GFPfluorescence. Animals from different strains showdifferent patterns: some glow green in the eyes,others in…6. Suppose a particular gene is required for early development and also later for development of a particulartissue, such as the adult nervous system. By generating a homozygous mutant clone in that tissue of a heterozygote, researchers can circumvent the lethalitythat would result if the entire animal is homozygousfor a loss-of-function mutation in that gene.A technique called MARCM (Mosaic Analysiswith a Repressible Cell Marker) was developed to enable Drosophila geneticists to generate homozygousmutant cell clones that are marked by the presence of areporter protein such as GFP. Marker expression enables the investigator to observe clearly the mutantphenotype within a clone of mutant cells. This technique relies on a yeast protein called Gal80 that is anegative regulator of the Gal4 protein described previously in Solved Problem II. Gal80 binds to Gal4 andprevents it from activating transcription. The idea ofMARCM is that Gal4/UASG-driven GFP expression isblocked by Gal80 throughout…
- 5. While exploring the human genome, a geneticist happens upon a gene in humans that is not functional and is not currently being expressed. This gene appears to be similar to the genes found in modern monkeys that cause tail formation. The most likely explanation for this gene in humans is Group of answer choices a. The gene is lying in wait for when it will be needed and then activated when the opportunity arises b. The gene is a conserved gene that serves an essential function in modern humans c. Humans are likely evolving a tail, and the gene will be expressed in the future d. The gene Is a random mutation of no significance e. The gene is a pseudogene leftover from when human ancestors had a tailLO: Explain how mutations in regulatory regions of genes differ from mutations in coding region The presence or absence of pelvic spines in the stickleback fish is controlled by whether the Pitx1 gene is expressed in the pelvic tissue. The Figure below shows how Pitx1 transcription is regulated in different tissues. The center image is that of a stickleback embryo. The drawings in the surrounding boxes show the Pitx1 gene region and activator proteins present in the jaw, pelvis, eye, or pituitary tissues. While the diagram only shows one activator in one tissue, many activators are present in a particular tissue at any one time. Activator molecules with specific shading can bind to switches with the same shading. 3a) Based on the diagram, in which tissues will the PitX1 gene be expressed? 3b) Assume a fish inherits a deletion mutation in the pituitary switch/enhancer sequence. You isolate DNA from jaw, pelvic, eye, and pituitary tissues. In the DNA of which tissue(s) would…2) Briefly describe 6 different ways that eukaryotic cells typically regulate Gene Expression
- 1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.1. What sequences form most of the human genome? What is their significance in the expression of genes?3. Figure 2 illustrates how Pitx1 transcription is regulated in different tissues. The center image is that of a stickleback embryo. The drawings in the surrounding boxes show the Pitx1 gene region and activator proteins present in the jaw, pelvis, eye, or pituitary tissues. a. List all the tissues shown in Figure 2 that express the Pitx1 gene. b. If a fish does not produce activator 1 proteins because of a mutation in the gene that encodes those proteins, Pitx1 will be expressed in which of the following tissues? c. If a fish does not produce activator 3 proteins, Pitx1 will be expressed in which of the following tissues? d. A fish inherits a mutation in the Pitx1 coding region. This is a nonsense mutation that introduces a premature stop codon, resulting in a nonfunctional protein. Where would you expect Pitx1 to be expressed in this scenario?
- 1)A. how do you read a sequence of DNA (template or non-template strand) to convert it an mRNA sequence and to a protein? B.How does chromatin remodeling regulate gene transcription? C. What are the major differences between gene expression in bacteria and eukaryotes D. How are non-coding regions involved in gene transcription? E. Explain how eukaryotic genes sometimes produce multiple protein products?The hunchback gene, a gene necessary for proper patterning of the Drosophila embryo, is translationallyregulated. The position of the coding region withinthe transcript is known. How could you determine ifthe sequences within the 5′ UTR or 3′ UTR, or both,are necessary for proper regulation of the mRNA’stranslation?Gene X is expressed in the developing brain, heart, andlungs of mice. Mutations that selectively affect gene Xfunction in these three tissues map to three differentregions (A, B, and C, respectively) 5′ of the X codingregion.a. Explain the nature of these mutations.b. Draw a map of the X locus consistent with the preceding information.c. How would you test the function of the A, B, and Cregions?