52A chromatogram showing the DNA sequence of the sense strand corresponding to a specific gene would contain both exons andintrons.Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.aTRUEFALSEUnanswereda Save53Why are dideoxy nucleotides used to sequence DNA?Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.aThey lack a 3'OHb.They are fluorescentThey lack a 5' phosphateThe nitrogenous bases can be identified individually

Note: Please repost the second question (53), as it is the policy to answer only one question at a…

52 A chromatogram showing the DNA sequence of the sense strand corresponding to a specific gene would contain both exons and introns. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a TRUE b FALSE

52 A chromatogram showing the DNA sequence of the sense strand corresponding to a specific gene would contain both exons and introns. Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a TRUE b FALSE

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Related questions

Q: 5' UGUCAUGCUCGUCUUGAAUCUUGU GAUCCUCGUUGGAUUAAUUGU— 3' Translate the sequence of bases in the…

A: The amino acid chains are produced from the mRNA by the process of translation. In this translation…

Q: 39 The Central Dogma describes the flow of genetic information as follows: Select an answer and…

A: DNA are genetic material which consist of genetic information that needs to passed from one…

Q: How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect…

A: Before an answer is given, the process of DNA replication must be understood. First there are two…

Q: SOURCE: GENERAL, ORGANIC AND BIOLOGICAL CHEMISTRY by Smith 4th Edition

A: DNA is the genetic material that carries genetic material in the form of coded nucleotide sequences.…

Q: c.) ( between turns, glycosidic bond conformation and sugar conformation differs between A-form DNA…

A: DNA, is basically called deoxyribonucleic acid, is the hereditary material in humans and almost all…

Q: In the Watson-Crick model of DNA structure: Question 5 options: T can form three hydrogen…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 63 What is the mRNA transcribed from the template strand of DNA shown below? 5' TATGGC 3' Select an…

A: The given template strand is 5' TATGGC 3'

Q: 17. Describe the Watson and Crick model of DNA structure.

A: DNA is the carrier of the genetic information from generation to generation.

Q: 52 Protein synthesis takes place on ( ). 53 The eukaryotic pathway of polypeptide chain elongation…

A: Question 52Protein synthesis takes place on ( ). 53 The eukaryotic pathway of polypeptide chain…

Q: 5' 3' For numbers 6 to 10, refer to the image above and answer the questions. 9. How are Okazaki…

A: Okazaki fragments : These are pieces of DNA which are the transient components of the lagging strand…

Q: 3b) During DNA replication, one new DNA strand is synthesized continuously but the other strand is…

A: DNA is a long polymer of nucleotides which makes the genetic material of most of the living organism…

Q: strand: (d) Specify the anticodon present on each of the transfer RNA's involved.

A: Deoxyribonucleic Acid (DNA) is a two-stranded biomolecule. It is a build-up of nucleotides. Distinct…

Q: What type of mutation (missense, silent, and non-sense) was introduced in your sequence when G was…

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: GivenA DNA sequence encoding a five-amino acid…

Q: 25.) The area indicated by the arrow is the A) sugar-phosphate backbone B) minor groove C) major…

A: Biochemistry is a branch of biology that deals with the structure, function and interaction of…

Q: 30) In the CRISPR system, the targeted DNA sequence is

A: CRISPR stands for clustered, regularly interspaced short palindromic repeats. Engineered CRISPR…

Q: DNA Double А A Helix C T C C MRNA A C C C Transcribed TRNA A Anticodon Amino Acid Pro Sequence Amino…

A: DNA has sense and antisense sequence, sense codons have the same bases as that of mRNA except that…

Q: 4. A double-stranded DNA molecule with the sequence shown below produces, in vivo, a polypeptide…

A: Transcription is the DNA dependent RNA synthesis. Process of transcription is catalyzed by RNA…

Q: What are SMC proteins? Describe the function of SMC proteins and explain how they might contribute…

A: Chromosomes must be supercoiled or they would not fit inside the nucleus (5 micrometers) of human…

Q: 38 In order to amplify a gene by PCR, one needs to know the exact DNA sequence of the regions…

A: Introduction:- Polymerase chain reaction (PCR) is a widely used method for rapidly producing…

Q: A double-stranded molecule of B DNA contains 340 nucleotidesWhat topic in genetics does this…

A: Nucleic acid is serving as primary information carrying molecule in cells. There are two types of…

Q: Why might a person make bad personal or lifestyle choices if she had knowledge of her genome?

A: It has been also studied that people who ate more raw fruits and vegetables had a reduced risk of…

Q: 48. The nuclear membrane is still intact to protect the DNA molecules from undergoing mutation A.…

A: Introduction Cell division:- It is the process by which cells divide and increase in number to…

Q: 62 The lagging strand is indicated by c 3' 5' a 9. 5' d 3' C e f a 5' 3' 3' 5' Select an answer and…

A: DNA replication is the process by which new DNA is synthesized from the old DNA molecule by…

Q: (c) Discuss the process of replication of DNA. (d) Derive Michaelis-Menten equation of enzymatic…

A: DNA is present in the nucleus of the cell and it is the genetic information that defines every…

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: Question S end shoephete adre GLare H H oyaene Pyimdine bemes HO OH a. Label the strands as being…

A: Biomolecules also known as biological molecule is any of the numerous substances that are produced…

Q: The actions of the mismatch repair system become especially critical in regions of DNA that carry…

A: Mismatch repair system is a type of DNA repair system where it replaces correct nucleotides in the…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: 47 If base #6 is changed from A to T, what type of mutation is this?? ANTISENSE STRAND 5' ATTTGACGG…

A: Antisense strand is also known as template strand. This strand is used to produce mRNA during…

Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…

A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…

Q: 50. Explain the Ribonuclease Experiment and why it was important.

A: Proteins are composed of polypeptides. Polypeptides are polymers of amino acids linked with each…

Q: the difference between DNA and ARN

A: DNA and RNA are the genetic material in the living organisms. They contain and pass the information…

Q: 62. Which of the following represents the sequence of the template strand?" A.…

A: DNA sequencing is a DNA sequencing method developed by Frederick Sanger in 1975, hence also called…

Q: VIII. James Watson and Francis Crick (Early 1960s) A. What did they recieve the Noble prize for? B.…

A: James Watson was born in Chicago III on April 6th ,1928 .His father's ancestors were mainly from…

Q: 36. Which is the sequence of steps used to amplify DNA with PCR during a single cycle? 1) Primers…

A: PCR is a technique that results in exponential amplification of a selected region of a DNA molecule…

Q: 50 A The Backbone of the DNA molecule is made of which componere(s) of the nucleotide shown in the…

A: DNA stands for deoxyribonucleic acid which is made up of two strands of polynucleotide chains in a…

Q: 6. What are the sides of the DNA ladder made of? a. b.

A: DNA or deoxyribonucleic acid is the molecule that contains genetic code of organisms. It forms a…

Q: RNA interference is initiated by the introduction of _______ into a cell. Group of answer choices…

A: According to the question:- RNAi which is also known as RNA interference , is RNA dependent gene…

Q: 34. Give the sequence of the complementary DNA strand of the DNA chain with the following base…

A: Complementarity refers to the lock-and-key relationship between two structures. Complementarity is a…

Q: 56. What is the chromosomal anomaly not detected by the technique given in the picture? Cy3 Cy5 a.…

A: Array CGH is an array based comparative DNA hybridization . It is a hybridization technique done on…

Q: 60 Which enzyme is involved in strand separation to begin the process of replication? Select an…

A: Enzyme Helicase breaks the hydrogen bonds present between nitrogen bases of 2 strands of DNA and…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Question

52
A chromatogram showing the DNA sequence of the sense strand corresponding to a specific gene would contain both exons and
introns.
Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.
a
TRUE
FALSE
Unanswered
a Save
53
Why are dideoxy nucleotides used to sequence DNA?
Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer.
a
They lack a 3'OH
b.
They are fluorescent
They lack a 5' phosphate
The nitrogenous bases can be identified individually

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Explanation

VIEW

Answer

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Give only typing answer with explanation and conclusion Write Dotplot alghorithm for finding inversions between the following DNAs in Python. Sequence 1: 5' - GCTAGGACCTTGATAGAACCATGCATGCATGCATGCAGTCTGGTCACTATGCCGTC - 3' Sequence 2: 5' - TACGTATCGGCGTTAGCGTAGCATGCATGCATGCATCGATGCCTAACGTTCTAAGC - 3'
If pET32a(+) is digested simultaneously with SacI and BclI i) How many fragments are created? ii) Write down the base pairs that result at the 5’ and 3’ ends of the shortest fragment.
What is the melting temp. of the following double-stranded DNA fragment CATCGCGATCTGCAATTACGACGATAA GTAGCGCTAGACGTTAATGCTGCTATT
If pET32a(+) is digested simultaneously with SacI and Bc1I 1. How many fragments are created? 2. Write down the base pairs that result at the 5’ and 3’ ends of the shortest fragment.
Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the segment of DNA: How many open reading frames (ORF) are in this sequence? How many amino acids are encoded in all open reading frames in this segment/sequence? Which strand is the template strand for the longest open reading frame?
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
18A. How many equivalents of ATP are required to replicate a 1000 bp stretch of DNA? B. If the incorrect nt is incorporated how many equivalents of ATP are required to fix this?
. In analyzing the number of different bases in a DNAsample, which result would be consistent with thebase-pairing rules?(A) A = G(B) A + G = C + T(C) A + T = G + C(D) A = C
Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it tend to cause a deletion to form, or an inversion? Diagram how it (either the deletion or inversion) will happen. xxxxxxxcatatgctttcag (another five hundred or so letters) catatgctttcagxxxxxxxxx Ditto, using this sequence xxxxxxxxcatatgctttcag (another five hundred or so letters) gactttcgtatacxxxxxxxxxxx
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
A student has drawn an enlarged portion of a DNA “ladder” model to show two of the nucleotides in greater detail (in the same orientation as they would occur in the ladder model). Which two nucleotides did the student draw?
Chargaff determined the base composition of DNA from a variety ofdifferent sources.What information do you know based onthe question and based on your understanding of thetopic?.