Define, explain and elaborate

Q: d. Which average molecular weight determination did the fraction 3 most significantly affect and…

A: We have to give the answer of the given questions. D. We have to tell which molecular weight…

Q: Differentiate between a synthesis experiment and a technique experiment. Must there be a difference…

A: A question based on tools in analytical chemistry that is to be accomplished.

Q: Agarose gel electrophoresis is relatively simple and straight forward to perform. Agarose is a…

A: two monomer units present in agarose are:

Q: Sequencing. Arrange the following procedures according to the CORRECT manner of preparing products.…

A: Turpuntine emulsion preparation AB AC  A B C E

Q: t-BUOK major product: Edit minor product: Edit

A:

Q: Please Answer all the following items will give thumbs up and good rating.  Matching type

A: 1) arithmetic mean 2) Degree of freedom 3) standard deviation  4) mean  deviation

Q: Calculate the following DNA concentrations and determine the purity of the samples: DNA Dilution…

A: Formula used :-  Concentration of double stranded DNA = 50 µg/mL × OD260 × dilution factor.

Q: In most cases, the positive fragment (anion) comes first before the negative fragment (cation). *…

A:

Q: ny grams are

A:

Q: 2b) please see attached

A:

Q: The figure below shows TEM micrograph of a rubber toughened polystyrene (PS) orthotic (i.e. rubber…

A: Diffrential scanning calorimetry: Differential scanning calorimetry is a technique in which the…

Q: 3500 3000 2500 2000 1500 1000 500 Movonumbor om Absorbance Units 00'0 0.05 0.10 0.15 0.20 0.25 0.30…

A: Some important peaks in IR spectrum of the unknown compound ae discussed below :  A. Medium peak at…

Q: Is there any difference between post-processing and post-treatment?

A: A question based on the terms used in chemical methods, which is to be accomplished.

Q: (9.29 × 105/8)-20.81 =  with correct sig figs

A: In measurement the number of digits in value is known as significant figure,  all non zero values…

Q: One of the following is not a method to break up emulsion: Select one: a. Salting-out b. Stirring c.…

A: An emulsion is a mixture of two or more liquids that are normally immiscible (unmixable or…

Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…

A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…

Q: Safari File Edit View History Bookmarks Window Help e e -) 82% 11, Wed 10:24 AM a cvg.cengagenow.com…

A: Organic chemistryBorane (BH3) reacts with ether (CH3OCH3) to form a complex.The reaction is shown in…

Q: Label and do

A: Use stoichiometric calculations to find the no. Of moles of carbon dioxide formed.

Q: None

A: Dear student I have given answer to your question in the image format.

Q: Hello, I would like help with problem 41 in the image attached.

A: Since you have posted a question with multiple sub-parts,we will solve first three sub-parts for…

Q: IUPAC and the omega-nomenclature of LCDs

A: Answer -  Omega-nomenclature - The Omega Nomenclature is almost exactly the same as the Delta…

Q: Please could someone explain this with terminology relevant to GCSE

A: Ethane is a saturated hydrocarbon while ethene is unsaturated hydrocarbon.

Q: Structure

A:

Q: What does cross peak X in Figure tell you

A: Given figure represents HETCOR spectrum. This explains the coupling between C and the protons bonded…

Q: Just prior to drying an organic layer with a drying agent, you notice water droplets in the organ…

A: We have to tell what we should do if the organic layer containing water droplets prior to drying…

Q: how would you isolate the glycosylated insulin from the unglhcosylated forms? can you come up with a…

A: In general, Insulin helps keep the glucose in your blood within a normal range by taking glucose out…

Q: What is meant by misorientation?

A: Misorientation has to be defined.

Q: Classify attached radical as 1°, 2°, or 3°.

A: The type of radicals can be identified as

Q: When an organic reaction is undergoing reflux, what are some potential errors (not human or…

A: A condenser which is used in organic chemistry which helps to safeguard reactant and solvent loss…

Q: How do we detect organic compounds and inorganic compounds used in GC analysis?

A: Gas Chromatography is an analytical technique used to separate various components inside the column…

Q: What are the types of MSDS forms.

A: MSDS forms means  Material Safety Data Sheet . It contains information about the various types of…

Q: Give a clear handwritten answer  ..?

A: Solid cobalt(II) nitrate is slowly added to 50.0 mL of a 0.0588 M Potassium  carbonate solution. The…

Q: Please give a clear image

A: In this question, we will draw a structural formula for the Product.  You can see details Solution…

Q: What are analytes and how can they be used for biochemical recognition?

A: The unknown biological compounds or elements, such enzyme substrate, complementary DNA, and antigen,…

Q: CI t-BUOK major product: Edit minor product: Edit

A:

Q: asap

A: Let us first calculate the value of pka of the acid.  pKa = -log(Ka)  Therefore, pKa1 =…

Q: The name for Cd(CIO2)2 is

A:

Q: Plywood and particle board are often glued with cheap, waterproof urea-formaldehyde resins. Two to…

A: The structure of Urea formaldehyde is The resin can be prepared by reaction of urea with…

Q: relative error caused by this deviation for each measu

A:

Q: What are annulenes ?

A: The compounds containing carbon and hydrogen only are termed as hydrocarbons. Hydrocarbons are…

Q: Briefly, discuss reflux and why it is commonly used in organic chemistry.

A: Here a term 'reflux' is given.Generally it is used in organic chemistry. We have to discuss about…

Q: R-Br Cut.pd Page 4 d Hu R-P

A: This is an example of Heck reaction. The hydrolysis of vinyl ether under acidic condition gives…

Q: 10. C4H,Br 100 80- 68- 42 20- 2922 8L82 1379 602T 1151

A: Degree of unsaturation of C4H9Br is  as    DU = 4-92-12+1=5-102=0NO degree of unsaturation…

Q: Please help me with assignments, please be sure to be clear thank you

A: Given data: Initial orbital n1 = 3, final orbital n2 = 8. The Rydberg formula to calculate…

Q: do 22 with explanation

A: Mass spectrometry is used to identify the molecular weight of the compound. Form the fragmentation…

Q: Show the step-by-step process. Do not use shortcut methods. Make it as detailed as it can be.…

A: Chiral centre is that carbon which is attached to the four different groups. If any one group is…

Q: Consider the diagram below to answer questions 5 and 6. R = 0.70 R = 0.55 R; = 0.47 Eluent: EtOAC…

A: Rf= 0.55 correspinding to compound 1. Since more is the polarity more will be the Rf value.  Thus…

Q: Fractioned Distillation Microscale Looking at this set up, are there any potential problems with…

A:

Q: Q. State whether the following statement is true or false. REWRITE A CORRECT STATEMENT if not true…

A: A question based on adsorption that is to be accomplished.