Answered: Conserved Strain A Strain B genes…

Conserved Strain A Strain B genes Strain C FIGURE 8.25 The Core Genome The genes that are conserved between strains make up the core genome.

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter15: Genes And Proteins

Section: Chapter Questions

Problem 27CTQ: Transcribe and translate the following DNA sequence (nontemplate strand): 5'- ATGGCCGGTTATTAAGCA-3'

See similar textbooks

Related questions

Q: How can DNA microarrays be used to determine which genes of a bacterial pathogen are expressed both…

A: DNA microarray or biochip is a technique wherein different DNA molecules are first attached to a…

Q: Why is this technique used?

A: All cells must synthesize some proteins for their cellular function. The instruction for protein…

Q: Conserved gene order can be termed asa) Orthologb) Syntenyc) Paralogd) Microarray

A: Gene is the functional unit of heredity that consists of DNA (Deoxyribonucleic acid). The DNA…

Q: DNA SEQUENCE IN FUNCTIONAL (UNAFFECTED) CFTR ALLELE DNA Gene Base ancestral Sequence:…

A: Since you have multiple questions, we're answering the first one for you. If you want any other…

Q: The beta subunits of E.coli DNA polymerase III are responsible for its _______. A. ribosome…

A: In prokaryotes, the DNA replication is carried out with the help of various enzymes, like, DNA…

Q: Why are some transposons medically important?

A: Certain sequences are repetitive such as satellite DNA, transposable elements, etc. They are studied…

Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Amino acid sequence of peptide:…

A: Point mutation

Q: Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of…

A: Here we provide you the Number of contigs formed from given sequences and the sequence of exon 3…

Q: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA sequence:…

A: Process by which DNA is copied to mRNA is called transcription. Process by which mRNA is used to…

Q: EboV RNA from Guinea Pig EboV RNA from Guinea Pig GAU ACG UUC GUC AAU EboV DNA CTA TGC AAG CAG TTA…

A: A missense mutation is a mistake in the DNA which results in the wrong amino acid being incorporated…

Q: A frameshift mutation could result from either an insertion or a deletion of a base deletion of…

A: Mutation refers to the process of sudden change or alterations in the sequence of nucleotides of an…

Q: 100 50 104 1 10 104 Cot DNA renaturation curves occasionally show three distinct phases of…

A: A single stranded DNA binds to its complementary strand to reform double stranded DNA is called…

Q: 100 50 10 1 10 10 Cot DNA renaturation curves occasionally show three distinct phases of rena-…

A: The denatured DNA can reformulate hydrogen bonds between complementary single strand, making it…

Q: Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that…

A: Mutation is defined as the change in the nucleotide sequence of DNA.

Q: Fig 3.16 EcoRI SacI Kpnl ampR Aval Xmal Smal lacZ BamHI Xbal Sall AccI HincII PstI Sphl HindIII Bam…

A: A bacterial protein termed restriction enzyme, also known as molecular scissors, cleaves DNA at…

Q: Can you please help with 1d please picture with 1 graph is for question 1a) picture with 4 graphs…

A: Binturong or the bearcat is found in South and Southeast Asia. It is declared as vulnerable,…

Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You

A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…

Q: 1a) E. coli DNA and binturong DNA are both 50% G-C. If you randomly shear E. coli DNA into 1000 bp…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via a…

Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…

A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…

Q: The third nitrogen base of a GENE has been replaced with the wrong base. The rest of the gene is…

A: Mutations are the changes in nitrogenous bases of DNA. Such changes can be beneficial or harmful…

Q: Below are fragments from a shotgun sequencing run of a single chromosome. On a separate piece of…

A: This sequencing is a laboratory technique used for the determining of DNA sequence of an organism's…

Q: Why are the first 20 bases typically ignored from a Sanger sequencing ab1 file? O The data quality…

A: The most commonly used tool for detecting SNVs is Sanger sequencing, it involves DNA polymerase…

Q: Match each of the terms in the left column to the bestfitting phrase from the right column.a. exome…

A: a. Exome: It is the part of a genome that contains all the exons.b. de novo gene: These are the new…

Q: CHOICES: Isoniazid Rifampicin Ethambutol None of the Choices Binds to bacterial DNA gyrase &…

A: DNA gyrase is an important enzyme that allows the bacteria to supercoil its NDA. The DNA gyrase is…

Q: The consensus sequence of the protospacer adjacent motif (PAM) sequence in bacterial strain A is…

A: For Cas9 to work, it additionally requires a particular protospacer adjacent motif (PAM) that…

Q: e. four-base, not overlapping4. An example of a portion of the T4 rIIB gene in whichCrick and…

A: The mutation is the alteration of the nucleotide sequence in an organism's genome. The mutation…

Q: You want to examine genetic variation in your gene promoter. You sequence DNA from several…

A: Single nucleotide polymorphism; it is a type of genetic variation which can occur throughout a…

Q: EboV from Guinea pig Reference DNA Sample mRNA Protein

A: The tiny living creatures such as bacteria, viruses, fungus, algae, and protozoa have a significant…

Q: Codon Chart: Transcribe then Translate! Gene 1- Lactase Enzyme Variation 1: Lactose Intolerant DNA:…

A: Every cell has a nucleus which houses genetic material ,the DNA. Genes are the segments of…

Q: Looking at each of the fragments (100, 200, 300 base pairs etc.). Why are there so many of the…

A: Restriction fragment length polymorphism (RFLP) is a type of polymorphism that results from…

Q: In Figure 5-18c, why is the crossover shown occurring inthe orange segments of DNA?

A: Crossing over is a process in which DNA or genes are exchanged between two homologous chromosomes…

Q: No Genome Left Behind and the Genome 10K Plan. Explain about this ?

A: The world has evolved. Ten years ago, it cost millions of dollars and many rooms filled with…

Q: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA…

A: In this question, we are given with a sequence of DNA which has a mutation. Given DNA sequence is…

Q: Please help me with the orange question. My answer is leading strand will encounter lagging strand.…

A: DNA replication takes place in a bidirectional mode in which both strands are replicated…

Q: What effect does the transposon have on the function of gene X in this figure?

A: Transposons are DNA segments that can migrate around in the genome of a single cell and take up…

Q: You are studying a genome that has 42% G:C content and the remaining 58% of the genome is As and Ts.…

A: Restriction enzymes The enzyme that is use to cut the DNA at specific site.

Q: BamHI Haell Both 10 kb 9 kb 8 kb 5 kb 2 kb 1 kb Figure 2 (i) How long is the original DNA molecule?…

A: Restriction digestion is a process in which DNA is cut at specific sites,

Q: Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’ Complementary DNA sequence: mRNA…

A: DNA molecule is the genetic material present in the animals. Genetic material is present in the…

Q: A. Diagram a short single strand of DNA 5’ -AA-GG- 3’. Show the chemical structure of the…

A: A nucleotide is the monomer that forms the polynucleotide strand which forms either a DNA or a RNA…

Q: When lambda DNA is cut with HinDIII what is the size in base-pairs of the smallest restriction…

A: Restriction enzyme cuts the DNA at specific recognition site. These are palindromic in nature.

Q: (AKS 8a2, DOK 1) A gel from gel electrophoresis is shown below B. Which DNA Fragment is the…

A: Gel electrophoresis is an analytical technique which is used for the separation of DNA; RNA and…

Q: On the image below what is the next nucleotide to be added on the oldest Okazaki fragment (use…

A: Answer- The next nucleotide to be added on the oldest Okazaki fragment will be in the direction 5'…

Q: a.) wanting to clone gene Z into pVector, the gene is amplified by PCR and restriction sites are…

A: Plasmid vectors provide a simple way of cloning small DNA fragments in bacterial and simple…

Q: The following DNA fragment shows where a number of restriction endonucleases cut sites occur within…

A: Restriction endonuclease Restriction endonucleases also called restriction enzymes are defined as…

Q: Some recombinant DNA techniques depend on the specific hybridization (or annealing) between two…

A: Recombinant DNA technology comprises altering genetic material outside an organism to obtain…

Q: In Figure 14-10, expressed sequence tags (ESTs) arealigned with genomic sequence. How are ESTs…

A: The full form pf EST is Expressed sequence tags. EST are the DNA sequences which are smaller in…

Q: Prokaryotes have a single circular chromosome while eukaryotes have linear chromosomes. Describe one…

A: Bacteria are single-celled prokaryotic organisms that grow in diverse environments and cannot be…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

What types of genes may make up the mobile gene pool?

Conserved
Strain A
Strain B
genes
Strain C
FIGURE 8.25 The Core Genome The genes that are conserved
between strains make up the core genome.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps with 2 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

5. Asap Repeated sequences can be classified according to theirorganization in the genome as well as according to theirfunction. Give at least two examples of each..
8. Given the following two sequences, create a pairwise alignment by hand. Do not place any gaps in the sequences to optimize alignment. Use an identity matrix and BLOSUM62 substitution matrix to create the two sets of pairwise alignments. Report the identity, identity score, similarity, and similarity score.Sequence 1: ATPL MSequence 2: ATKI M
BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would be created by cutting the normal gene with BamHI?
COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
Provide a brief summary of the Sanger sequencing method.
. The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?
Whole-exome sequencing (WES) is helping physicians diagnosea genetic condition that has defied diagnosis by traditionalmeans. The implication here is that exons in the nucleargenome are sequenced in the hopes that, by comparison withthe genomes of nonaffected individuals, a diagnosis might berevealed. What are the strengths and weaknesses of this approach?
28. Approximately 50 % of the human genome is composed of a. protein-coding genes b. ribosomal RNA genes c. mobile genetic elements like transposons and retrotransposons d. introns e. promoter sequences.
The goal of structural proteomics project isa) To crystallize and determine the structure of as many proteins as possible, in many cases with little or no existing information about protein functionb) To identify and sequence of all the genes present in the human bodyc) To introduce new genes to human beingsd) To remove disease causing genes from humans
To determine the reproducibility of mutation fre-quency measurements, you do the following experiment.You inoculate each of 10 cultures with a single E. coli bac-terium, allow the cultures to grow until each contains 106cells, and then measure the number of cells in each culturethat carry a mutation in your gene of interest. You were sosurprised by the initial results that you repeated the experi-ment to confirm them. Both sets of results display the sameextreme variability, as shown in Table Q5–1. Assuming thatthe rate of mutation is constant, why do you suppose thereis so much variation in the frequencies of mutant cells indifferent cultures?
2c) If the whole potoroo genome is 4.2 x 10' bp, and the highlyrepetitive DNA in the potoroo genome is composed entirely ofcopies of the sequence 5'AAGACT' and its complement, howmany copies of this sequence are present in the potoroogenome?