Homework Help is Here – Start Your Trial Now!
Science
Biochemistry
Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6 gene Figure I shows one of the mutations in the MT-ATP6 gene that can cause Leigh syndrome Table I contains some of the DNA codons that code for particular amino acids rks Table 1 Amino acid DNA codo Isoleucine ATT, ATC, ATA Glutamate GAA, GAG Figure I Original gene: CAACCAATAGCCCTGGCCGTA Mutated gene: CAACCAATAGCCCGGGCCGTA Leucine CTG, TTA, TTG Methionine ATG Valine GTT, GTC, GTA, GTG Arginine CGG, AGA Alanine GCT, GCC, GCA, GCG (a) Give one piece of evidence from Table 1 that shows the genetic code is degenerate. (b) (i) Describe the effect that the mutation shown in Figure 1 will have on the mRNA sequence produced from the MT-ATP6 gene. (ii) Using Table 1 for refere.ce, describe the effect that the mutation shown in Figure 1 will have on the primary structure of the nrotein produced from the MT-ATP6 gene.

Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6 gene Figure I shows one of the mutations in the MT-ATP6 gene that can cause Leigh syndrome Table I contains some of the DNA codons that code for particular amino acids rks Table 1 Amino acid DNA codo Isoleucine ATT, ATC, ATA Glutamate GAA, GAG Figure I Original gene: CAACCAATAGCCCTGGCCGTA Mutated gene: CAACCAATAGCCCGGGCCGTA Leucine CTG, TTA, TTG Methionine ATG Valine GTT, GTC, GTA, GTG Arginine CGG, AGA Alanine GCT, GCC, GCA, GCG (a) Give one piece of evidence from Table 1 that shows the genetic code is degenerate. (b) (i) Describe the effect that the mutation shown in Figure 1 will have on the mRNA sequence produced from the MT-ATP6 gene. (ii) Using Table 1 for refere.ce, describe the effect that the mutation shown in Figure 1 will have on the primary structure of the nrotein produced from the MT-ATP6 gene.

Biochemistry
Biochemistry
6th Edition
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Reginald H. Garrett, Charles M. Grisham
Chapter30: Protein Synthesis
Section: Chapter Questions
Problem 2P
See similar textbooks
icon
Related questions
Question
Any question please
Leigh omdrome a metabolic disorder that affects the central nervous system sed by a mutation in the MT-ATP6 gene Figure I shows one of the mutations in the MT-ATP6 gene that can cause Leigh syndrome. Table I contains some of the DNA codons that code for particular amino acids. rks Table 1 Amino acid DNA codon Isoleucine ATT, ATC, ATA Glutamate GAA, GAG Figure I CTG, TTA, TTG Original gene: CAACCAATAGCCCTGGCCGTA Mutated gene: CAACCAATAGCCCGGGCCGTA Leucine ATG Methionine Valine GTT, GTC, GTA, GTG cs) Arginine CGG, AGA Alanine GCT, GCC, GCA, GCG (a) Give one piece of evidence from Table 1 that shows the genetic code is degenerate. (b) (i) Describe the effect that the mutation shown in Figure 1 will have on the mRNA sequence produced from the MT-ATP6 gene. (ii) Using Table 1 for refere.ce, describe the effect that the mutation shown in Figure 1 will have on the primary structure of the nrotein produced from the MT-ATP6 gene. ..... ........
Transcribed Image Text:Leigh omdrome a metabolic disorder that affects the central nervous system sed by a mutation in the MT-ATP6 gene Figure I shows one of the mutations in the MT-ATP6 gene that can cause Leigh syndrome. Table I contains some of the DNA codons that code for particular amino acids. rks Table 1 Amino acid DNA codon Isoleucine ATT, ATC, ATA Glutamate GAA, GAG Figure I CTG, TTA, TTG Original gene: CAACCAATAGCCCTGGCCGTA Mutated gene: CAACCAATAGCCCGGGCCGTA Leucine ATG Methionine Valine GTT, GTC, GTA, GTG cs) Arginine CGG, AGA Alanine GCT, GCC, GCA, GCG (a) Give one piece of evidence from Table 1 that shows the genetic code is degenerate. (b) (i) Describe the effect that the mutation shown in Figure 1 will have on the mRNA sequence produced from the MT-ATP6 gene. (ii) Using Table 1 for refere.ce, describe the effect that the mutation shown in Figure 1 will have on the primary structure of the nrotein produced from the MT-ATP6 gene. ..... ........
Expert Solution
steps

Step by step

Solved in 3 steps with 1 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biochemistry
Biochemistry
Biochemistry
ISBN:
9781305577206
Author:
Reginald H. Garrett, Charles M. Grisham
Publisher:
Cengage Learning
Human Heredity: Principles and Issues (MindTap Co…
Human Heredity: Principles and Issues (MindTap Co…
Biology
ISBN:
9781305251052
Author:
Michael Cummings
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS