om college and started working at a biotech startup called Scrofa first job assignment is to clone the pig gene for the hormone prolactin. Assume that th for prolactin has not yet been isolated, sequenced, or mapped; What would be the mo economical first step to go about identifying and cloning the pig gene for prolactin? use the amino acid sequence of mouse prolactin to to PCR-amnlifu
Q: In PCR reactions, 0 is used as building "bricks" for DNA replication. O ATP OUNTP NAD O DNA…
A: The foundation of PCR is the DNA polymerase's capacity to create new DNA strands that are…
Q: A piece of human DNA is treated with two common restriction enzymes. The DNA piece in question is 50…
A: Restriction enzymes are a specific group of enzymes that can recognize a specific short sequence of…
Q: Is the amount of DNA an organism has correlated to intelligence or complexity? What are two…
A: The genome of an organism is defined as the whole or entire set of chromosomes or genes present in…
Q: Short tandem repeats (STR) profiling is based on O A. the fact that many foods are being genetically…
A: The method of DNA profiling used today is based on PCR and uses simple sequences or short tandem…
Q: What was the scientist's error in naming noncoding DNA “junk” DNA. Is the amount of DNA an organism…
A: What was the scientist's error in naming noncoding DNA “junk” DNA.
Q: Until recently, the Basque people of Europe were thought to have descended directly from…
A: Basques are indigenous to and primarily inhabit an area traditionally known as the Basque Country…
Q: 6. Refer to the figure answer the following questions. CLUSTAL W (1.83) multiple sequence alignment…
A: DNA is the genetic material for many multicellular organisms. The DNA present in all organisms is…
Q: When molecular biologists carry out a PCR, they have a range of different DNA polymerase enzymes on…
A: Polymerase chain reaction (PCR) is a frequently used approach for rapidly producing millions or even…
Q: DNA microarrays (gene chips) are only capable of monitoring the expression of one gene at a time. O…
A: DNA microarray ( gene chips) are only capable of monitoring the expression of one gene at a time.…
Q: You need to do a genomic DNA extraction, but you have run out of solutions in the lab. Knowing the…
A: Genomic dna isolation includes 3 basic steps: Cell lysis using SDS, Triton-X etc. Addition of…
Q: Page 6 of 6 Describe the cloning vectors that would be used to clone each of the following DNA…
A: A cloning vector is a short fragment of DNA that allows the incorporation of foreign DNA for…
Q: The main aim of human genome project isa) To identify and sequence of all the genes present in the…
A: Organisms have DNA/ RNA as their genetic material. This genetic material is responsible for…
Q: Real-time PCR is used in many transcription? Select one or more: O a. Gene transcription qu b. Ob.…
A: Note- According to the guidelines only one question can be answered at a time. Hence, the first…
Q: What did some think about Watson and Crick that they would not be productive
A: DNA has a double-helix structure, with sugar and phosphate on the outside of the helix, forming the…
Q: rue for Sequence tagged site (STS) markers: e mapped by fluorescence in situ hybridization (FISH)…
A: sequence-tagged site (or STS) is a short (200 to 500 base pair) DNA sequence that has a single…
Q: What was the Mendel’s definition of a gene? How was it different from the definition by Beadle and…
A: Please note that keeping with regulations the first 3 questions (actually 5) are answered below,…
Q: Examine the DNA sequence shown below. You have been tasked with designing Primers for PCR…
A: Polymerase chain reaction (PCR) is a method widely used to make many copies of a specific DNA…
Q: 1. You are a research assistant in a renowned science academy. Your supervisor requires you to…
A: PCR:- it is used to amplify the fragments of a DNA or gene of interest. Gene cloning:- it is a…
Q: Recombinant DNA technology describes a set of molecular techniques that allow us to do what with…
A: Recombinant DNA technology involves techniques like restriction digestion, polymerase chain reaction…
Q: True/False True or False? Transposon mutagenesis is useful for identifying essential genes in a…
A: A DNA sequence defines a transposon, which is a collection of mobile genetic elements. Transposons…
Q: Great! Now you've got the Wooly Mammoth hemoglobin gene sequence with just the exons! You generate a…
A: Restriction enzymes are a specific group of enzymes that can recognize a specific short sequence of…
Q: EXPERIMENT #4: POLYMERASE CHAIN REACTION Purpose: Using PCR technique, amplify the region of…
A: PCR- polymerase chain reaction is defined as the process of amplification of the fragments of the…
Q: Bob's telomerase works extremely well (10x better than the average humans). Explain the function of…
A: Telomerase is an enzyme. It maintains length of telomere by adding repetative sequence that are…
Q: Part II. Give what is needed. |Original DNA Sequence: TACACCT T G G C G A C G A C T MRNA Sequence: |…
A: Q. Frameshift mutation: A frameshift mutation is a genetic mutation that occurs when a deletion or…
Q: You've ordered and received your "primers" for your PCR. Now what? In your new role as an MLA your…
A: A primer is a short, single-stranded DNA sequence which is used in the polymerase chain reaction…
Q: Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind…
A: It is difficult for one to to find out gene of interest out of a complete genome. However, a given…
Q: uld be genetically transformed. The evidence that DNA was the transforming principle responsible for…
A: INTRODUCTION In the human body, DNA is the carrier of the genetic material. DNA is the…
Q: PCR is quick, efficient and easy to perform. However, there are some situations when cell-based…
A: PCR which stands for polymerization chain reaction is an analytic technique which is used to amplify…
Q: he ability to multiplex the PCR reactions used in STR analysis (many PCR amplifications occurring in…
A: Dr.Kary Mullis invented the polymerase chain reaction (PCR) in 1983. The enzyme used in this…
Q: You have completed an in vitro mutagenesis experiment to create an G to Tmutation in the coding…
A: After first being developed by Frederick Sanger and colleagues in 1977, Sanger sequencing became the…
Q: 4 sports = Gly, Val 8 legs = Val, His, lle, Tyr Straight antennae = Ala, lle, lle Start codon = AUG…
A: For 4 spots, 8 legs and straight antennae the peptide would be Met-Gly-Val-His-Ile-Tyr-ala-Ile-Ile…
Q: possible evolution of the genes that “SEQUENCE_21” to “SEQUENCE_27” represent
A: Rab proteins are the largest family of monomeric GTPases and they belong to the Ras superfamily. Rab…
Q: After you design the PCR primers, you run the PCR on fluid from the patient’s nasal swab. Next, you…
A: Gel electrophoresis is the widely used technique in molecular biology for the separation of the…
Q: SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the…
A: The bioinformatic is major computational biology used to find the nucleotide, protein sequence of…
Q: Yes or no? DAPI just stains dna in testes and sperm of planarian. A of riboprobe duryin situ…
A: Introduction :- DNA molecule acts as the genetic material of the cell and is made of polynucleotide…
Q: PCR is a way for scientists to amplify DNA using primers and a special heat resistant polymerase.…
A: PCR or polymerase chain reaction is a technique in which a part of DNA can be amplified many many…
Q: Polymerase Chain Reaction (PCR) was invented by Kary Mullis in 1983. This technique had indeed…
A: In molecular biology, PCR (Polymerase Chain Reaction) is a common tool which is used in making…
Q: . The website CBioPortal (http://www.cbioportal.org)is an exceptionally useful program for…
A: Oncogene is a gene that is responsible for causing cancer. Tumor-suppressor genes are normal genes…
Q: Sample Gel Electrophoresis: A brother and sister's DNA are cut with the same restriction enzyme and…
A: Gel electrophoresis is a technique used to separate DNA fragments according to their size.
Q: fellow lab worker brings you DNA containing what might be a similar gene in Leopard Geckos (XG). She…
A: Polymerase chain reaction (PCR) involves amplification of a nucleotide sequence using respective…
Q: Ap Normal No Spacing Head 目三。、田 Paragraph Styles 1. You heve a circuler plasmid (pUC57), which…
A: We are allowed to do one or upto three subpart of a question. Please repost the undone question…
Q: II Pause (AKS 8a, DOK 2) A transgenic organism receives genes from other organisms. The newly formed…
A: Transgenic organisms are those in which DNA sequences from other species are introduced into the…
Q: Lab 10- PCR For the following equipment, know what it looks like, its name, and its function:…
A: 1) A micropipette is a laboratory instrument used to accurately and precisely transfer volumes…
Q: which genes that are normally found in a lambda genome would be deleted in your lambda vector?…
A: Lambda phage is also known as enterobacteria phage lambda or coliphage lambda is a phage species…
Q: Wooly Mammoths have been extinct for about 10,000 years; however, their remains have been well…
A: The Earth was formed several million years ago that was recorded to harbour many plants and animals…
Q: You have been given the DNA sequence for a particular fragment of DNA. You then isolated the mRNA…
A: The correct answer is option b. Deoxyribonucleic acid helix is made up of four nitrogenous bases,…
Q: a. Discuss the genetic potential of the cloning of single genes, cells, organs, and entire…
A: CLONING Cloning is a molecular technique involving the protocols to generate similar identical…
Q: UCSC Genome Browser on D. melanogaster July 2014 (Gene) Assembly (dm3gene) move » >>> zoom in 1.5x…
A: Exons are the coding region and these exons result in the formation of functional protein or enzyme.
Q: (AKS 8a, DOK 2) Students in biology classes at MHS have been conducting an experiment that invloves…
A: Genetic engineering technique is the technique of biotechnology in which the required genes are…
Answer that attached question
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Here another DNA sequence that will amplify another gene known to confer the ability to taste additional bitter compound. You would like to perform a PCR to amplify this sequence. Which pair of primers was used to amplify this sequence? 5' TAGAAAAGGAAGGTGGCTCCTACAAATGCCATCATTCTCTGCCGAATCAGTGGTCCCAAAGATGGA GTGGTCCCAAAGATGGACCCCCACCCACGAGGAGCATCGTGGAAAAAGAAGACGTTCCAACCACC 3' 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-TTGAAGACGTGGTTGGAA-3' O 5'-AGCCACCTTCCTTTTCTA-3' and 5'-AACTTCTGCACCAACCTT-3' O 5'-TTGAAGACGTGGTTGGAA-3' and 5'-AGCCACCTTCCTTTTCTA-3' O 5'-TAGAAAAGGAAGGTGGCT-3' and 5'-AACTTCTGCACCAACCTT-3'. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNAWhich goals of the Human Genome Project do you think are themost important? Why? Discuss the types of ethical problems thatmight arise as a result of identifying all of our genes.
- Your advisor, a brilliant bioinformatician, has high regard for your intellect and industry. she suggests that you write a computer program that will identify the exons of protein- coding genes directly from the sequence of the human genome. In preparation for that task, you decide to write down a list of the features that might distinguish protein- coding sequences from intronic DNA and from other sequences in the genome. What features would you list?If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not? Primers can sometimes bind and target the wrong gene, especially if the primers are allowed to bind to the DNA strands at a low temperature. PCR also preferentially amplify short segments of DNA. Would it be important to actually run the cDNA after the PCR on a DNA gel in order to check for a PCR product of the predicted size for the insulin gene? Why or why not?When doing a lab that involves Extraction of Genomic DNA from adult Drosophila melanogaster. - What are the controls you should use and why use these? What is special about the genomic DNA? What do you expect to find (using these genomic DNA samples)? please help!
- Ali sequenced a plant protein. He is not a bioinformatician and is actually scared of computers. Yet, he would like to know what the structure might look like to do some rounds of rational mutagenesis. I told him I would collect a group of bioinformaticians to solve this problem. Please don't disappoint him. He came up with this sequence: SVCCPSLVARTNYNVCRLPGTEAALCATFTGCIIIPGATCGGDYAN Find the template? Use swiss model to build the structure?Scientists are interested in cloning an extinct animal called the gastricbrooding frog. This strange frog swallows its eggs and broods itsyoung within its stomach. So far, scientists have successfully usedcloning to make an embryo of the frog, but they have yet to raise oneto maturity. What steps might the scientists have used to clone thisextinct species? Why was it important for scientists to determinebefore the experiments that the great barred frog is a close relative tothe gastric brooding frog?You’ve made your construct and placed it into E. coli! Congratulations, you have made a transgenic organism. Your investors will want to know about quality control. How will you check that the correct piece of DNA is in your vector? How will you check to make sure the gene is transcribed? How will you check to make sure that the GasP protein is made in E. coli? Your investors are concerned that the GasP protein might not be sufficiently produced under normal laboratory conditions. They suggest controlling the transcription of the gasP gene using a chemical that will “trigger” its transcription. What type of promoter could be used? What chemical will you use to control transcription? How does this method of control work?
- In contrast with the genomic manipulations of animals and plants described in this chapter, human genetherapy is directed specifically at altering the genomes of somatic cells rather than germ-line cells.Why couldn’t or wouldn’t medical scientists try to alter the genome of human germ-line cells?You have isolated a transposable element from the human genome and have determined its DNA sequence.How would you use this sequence to determine thecopy number of the element in the human genome ifyou just had a computer with an Internet connection?If you knew the mRNA sequence for the human insulin gene could you know what size cDNA fragment you would find on your DNA gel when you ran it against a size standard (a “molecular ruler”)? Would you continue with your insulin cloning experiment, if the DNA from your PCR was very different in size from that predicted by the insulin mRNA? Why or why not?