Biochemistry
8th Edition
ISBN: 9781464126109
Author: Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr., Lubert Stryer
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 10, Problem 5P
Interpretation Introduction
Interpretation:
The effect of a mutation in an allosteric enzyme that resulted in a
Concept introduction:
Enzymes being the catalysts increase the
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
. Geneticists interested in human hemoglobins havefound a very large number of mutant forms. Some ofthese mutant proteins are of normal size (but haveamino acid substitutions) while others are short, dueto deletions or nonsense mutations. The first extralong example was named Hb Constant Spring, inwhich the β-globin has all of its normal amino acidsplus several extra amino acids attached after thenormal C-terminal end of the protein. a. What is the most plausible explanation forits origin?b. Is it possible that Hb Constant Spring arose fromfailure to splice out an intron?c. Estimate how many extra amino acids mightbe added to the C terminal end of the mutantprotein
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
GTTTTCACTGGCGAGCGTCATCTTCCTACT
8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Chapter 10 Solutions
Biochemistry
Ch. 10 - Prob. 1PCh. 10 - Prob. 2PCh. 10 - Prob. 3PCh. 10 - Prob. 4PCh. 10 - Prob. 5PCh. 10 - Prob. 6PCh. 10 - Prob. 7PCh. 10 - Prob. 8PCh. 10 - Prob. 9PCh. 10 - Prob. 10P
Ch. 10 - Prob. 11PCh. 10 - Prob. 12PCh. 10 - Prob. 13PCh. 10 - Prob. 14PCh. 10 - Prob. 15PCh. 10 - Prob. 16PCh. 10 - Prob. 17PCh. 10 - Prob. 18PCh. 10 - Prob. 19PCh. 10 - Prob. 20PCh. 10 - Prob. 21PCh. 10 - Prob. 22PCh. 10 - Prob. 23PCh. 10 - Prob. 24PCh. 10 - Prob. 25PCh. 10 - Prob. 26PCh. 10 - Prob. 27PCh. 10 - Prob. 28PCh. 10 - Prob. 29PCh. 10 - Prob. 30PCh. 10 - Prob. 31PCh. 10 - Prob. 32PCh. 10 - Prob. 33PCh. 10 - Prob. 34PCh. 10 - Prob. 35PCh. 10 - Prob. 36PCh. 10 - Prob. 37PCh. 10 - Prob. 38PCh. 10 - Prob. 39PCh. 10 - Prob. 40PCh. 10 - Prob. 41P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Homozygosity for extremely rare mutations in a humangene called SCN9A cause complete insensitivity topain (congenital pain insensitivity or CPA) and a totallack of the sense of smell (anosmia). The SCN9A geneencodes a sodium channel protein required for transmission of electrical signals from particular nerves inthe body to the brain. The failure to feel pain is a dangerous condition as people cannot sense injuries.The SCN9A gene has 26 exons and encodes a1977-amino acid polypeptide. Consanguineous matings in three different families have resulted in individuals with CPA/anosmia. In Family 1, a G-to-Atransition in exon 15 results in a truncated protein that is898 amino acids long; in Family 2, deletion of a singlebase results in a 766-amino acid polypeptide; and inFamily 3, a C-to-G transversion in exon 10 yields a458-amino acid protein.a. Hypothesize as to how each of the three SCN9Amutations affects gene structure: Why are truncatedproteins made in each case? b. How would you…arrow_forwardSickle cell hemoglobin DNA CACGTAGACTGAGG ACAC.. Sickle cell hemoglobin MRNA Sickle cell hemoglobin AA sequence 4. What type of mutation is this? Please explain why.arrow_forwardCytosine deaminationoccurs ~100 cytosinesper genome per day in a human genome. Eukaryotic cells also contain residues of 5’-methylcytosine, which is involved in regulating gene transcription rates. Mutation of 5’-methylcytosine by deaminationconverts it to thymine. This presents the cell with a much more severe problem than normal cytosine deaminationof cytosine to uracil. Why?arrow_forward
- . The double-stranded circular DNA molecule thatforms the genome of the SV40 tumor virus can be denatured into single-stranded DNA molecules. Becausethe base composition of the two strands differs, thestrands can be separated on the basis of their densityinto two strands designated W(atson) and C(rick). When each of the purified preparations of the single strands was mixed with mRNA from cells infectedwith the virus, hybrids were formed between the RNAand DNA. Closer analysis of these hybridizationsshowed that RNAs that hybridized with the W preparation were different from RNAs that hybridized withthe C preparation. What does this tell you about thetranscription templates for the different classes ofRNAs?arrow_forwardHN, NH. NH H2N° А. В. Consider the 3 structures shown. Which of these is (normally) NOT present in either DNA or RNA? (select all that apply) А В none of the above ZI C.arrow_forward. Explain why DNA is stable in the presence of alkali (0.3 M KOH), while RNA is quantitatively degraded to 2'- and 3'-nucleoside monophosphates under these conditions.arrow_forward
- On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.arrow_forwardThe intermediates A, B, C, D, E, and F all occur inthe same biochemical pathway. G is the product of thepathway, and mutants 1 through 7 are all G−, meaningthat they cannot produce substance G. The followingtable shows which intermediates will promote growthin each of the mutants. Arrange the intermediates inorder of their occurrence in the pathway, and indicatethe step in the pathway at which each mutant strain isblocked. A + in the table indicates that the strain willgrow if given that substance, an O means lack of growth.SupplementsMutant A B C D E F G1 + + + + + O +2 O O O O O O +3 O + + O + O +4 O + O O + O +5 + + + O + O +6 + + + + + + +7 O O O O + O +arrow_forward. A geneticist examined the amino acid sequence of aparticular protein in a variety of E. coli mutants. Theamino acid in position 40 in the normal enzyme isglycine. The following table shows the substitutionsthe geneticist found at amino acid position 40 in sixmutant forms of the enzyme.mutant 1 cysteinemutant 2 valinemutant 3 serinemutant 4 aspartic acidmutant 5 argininemutant 6 alanineDetermine the nature of the base substitution thatmust have occurred in the DNA in each case. Whichof these mutants would be capable of recombinationwith mutant 1 to form a wild-type gene?arrow_forward
- b. Which one of the following a cell mutants will be able to switch at least once? [Select]arrow_forwardConsider the following two nonhomologous wildtype chromosomes, where letters or numbers represent genes, the "-" represents the centromere of each chromosome, and chromosomes are shown on separate lines. ABCDE-FGHIJK 123-45678 Identify the type of rearrangement shown in each of the following (A-C) and then identify whether it is balanced or unbalanced. Assume that the individual is diploid and heterozygous for the rearrangement. A. • ABCDE-FGHIJKGH 123-45678 Rearrangement: [Select] • Balanced or Unbalanced: [Select] B. • ABCDGF-EHIJK 123-45678 Rearrangement ✓ [Select] • Balanced or Un pericentric inversion Robertsonian translocation deletion tandem duplicate paracentric inversion C. reciprocal translocation ABCDE dispersed duplicate nonreciprocal translocation 123-45arrow_forward8a. Given the following mutated sequence (with respect to the normal sequence), what TYPE of mutation occurred: AAACGTTAC 8b. Where did the mutation take place?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. FreemanLehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. FreemanFundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
- BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage LearningBiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage LearningFundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY