Genetics: From Genes To Genomes (6th International Edition)
Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
Question
Book Icon
Chapter 11, Problem 11P
Summary Introduction

Introduction:

Primers may be defined as the oligonuceotide strands of nucleotides of DNA and RNA. It serves as an initiaton point for DNA replication.

Blurred answer
Students have asked these similar questions
Which of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'
Design 6 bp primers to amplify the region of this sequence that is highlighted in yellow. attatatttt atattatata ctctgggctc agagcagccc 40 41 atattatata tatatatttt aaaatattat aaatttattt 80 81 cagtcacgcg tcctgatgac attatatttt ataatttttt 120 121 ttttattttt attatatttt aaaatattat aaatttattt 160 161 aaaatattat tatatattta aaatttattt attataaaat 200 201 aaaatattat ttttattttt gagatcagga cggctgcatg 240 Forward primer Reverse primer
For the following sequence design the forward and reverse primer... explain and justify your answer. Full sequence would be:  1 tctagagtca tgaaacaaca aaaacggctt tacgcccgat tgctgacgct gttatttgcg 61 ctcatcttct tgctgcctca ttctgcagca gcggcggcaa atcttaatgg gacgctgatg 121 cagtattttg aatggtacat gcccaatgac ggccaacatt ggaagcgttt gcaaaacgac 181 tcggcatatt tggctgaaca cggtattact gccgtctgga ttcccccggc atataaggga 241 acgagccaag cggatgtggg ctacggtgct tacgaccttt atgatttagg ggagtttcat 301 caaaaaggga cggttcggac aaagtacggc acaaaaggag agctgcaatc tgcgatcaaa 361 agtcttcatt cccgcgacat taacgtttac ggggatgtgg tcatcaacca caaaggcggc 421 gctgatgcga ccgaagatgt aaccgcggtt gaagtcgatc ccgctgaccg caaccgcgta 481 atttcaggag aacacctaat taaagcctgg acacattttc attttccggg gcgcggcagc 541 acatacagcg attttaaatg gcattggtac cattttgacg gaaccgattg ggacgagtcc 601 cgaaagctga accgcatcta taagtttcaa ggaaaggctt gggattggga agtttccaat 661 gaaaacggca actatgatta tttgatgtat gccgacatcg attatgacca tcctgatgtc 721 gcagcagaaa ttaagagatg gggcacttgg…

Chapter 11 Solutions

Genetics: From Genes To Genomes (6th International Edition)

Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Background pattern image
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education