Genetics: From Genes To Genomes (6th International Edition)
6th Edition
ISBN: 9781260041217
Author: Leland Hartwell Dr., ? Michael L. Goldberg Professor Dr., ? Janice Fischer, ? Leroy Hood Dr.
Publisher: Mcgraw-Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 11, Problem 22P
Microarrays were used to determine the genotypes of seven embryos (made by in vitro fertilization) with regard to sickle-cell anemia. Each pair of squares in the accompanying figure represents two ASOs, one specific for the HbβA allele (A) and the other for the HBβ allele (T), attached to a chip of silicon and hybridized with fluorescently labeled PCR product from a single cell from one of the embryos. The hybridizations were performed at three different temperatures (80°C, 60°C, and 40°C) as shown.
| a. | Why do you think the PCR step is needed for this microarray analysis? |
| b. | Make a sketch of the location in genomic DNA of the PCR primers relative to the sickle-cell mutation. Indicate the 5′-to-3′ polarities of all DNA molecules involved. |
| c. | Why is no hybridization seen at 80°C? |
| d. | Why do you see strong hybridization of all genomic DNA probes to both ASOs at 40°C? |
| e. | What are the genotypes of the seven embryos? Which of these embryos would you choose to implant into the mother’s uterus to avoid the possibility that the child would have sickle-cell anemia? |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
In a typical PCR reaction, describe what is happening in stages occurring at temperature ranges (a) 92–95°C, (b) 45–65°C, and (c) 65–75°C.
Irreversible organ failure remains a worldwide concern as demand for transplantable organs far outpaces the
available supply. To overcome this shortage, xenotransplantation, where tissues or organs from animals are
transplanted into humans has been tested with limited success since the early 1900's. Factors affecting the
outcome of transplantation across the xenogeneic barrier include both humoral (innate) and cell-mediated
(innate/adaptive) immune responses. Despite the development of strategies to achieve immunological
tolerance, xenotransplantation is not yet a clinical reality. Indeed, while organ rejection can be avoided, the
risk of an infectious or zoonotic disease spreading from animals to humans raises further concerns about the
clinical application of xenotransplantation. By the late 1990s, the advent of stem cell research had sparked a
new direction in the field of regenerative medicine. As an alternative to generating organs from induced
pluripotent stem cells (iPSCS) in…
let three loci be X,Y,Z. three pairs of primes can be used to amplify these loci in multiplex PCR. the resulting amplicons(from different loci) are of the equal size. will this scenario be acceptable in STR typing? why or why not?
Chapter 11 Solutions
Genetics: From Genes To Genomes (6th International Edition)
Ch. 11 - Choose the phrase from the right column that best...Ch. 11 - Would you characterize the pattern of inheritance...Ch. 11 - Would you be more likely to find single nucleotide...Ch. 11 - A recent estimate of the rate of base...Ch. 11 - If you examine Fig. 11.5 closely, you will note...Ch. 11 - Approximately 50 million SNPs have thus far been...Ch. 11 - Mutations at simple sequence repeat SSR loci occur...Ch. 11 - Humans and gorillas last shared a common ancestor...Ch. 11 - In 2015, an international team of scientists...Ch. 11 - Using PCR, you want to amplify an approximately 1...
Ch. 11 - Prob. 11PCh. 11 - The previous problem raises several interesting...Ch. 11 - You want to make a recombinant DNA in which a PCR...Ch. 11 - You sequence a PCR product amplified from a...Ch. 11 - Prob. 15PCh. 11 - The trinucleotide repeat region of the Huntington...Ch. 11 - Sperm samples were taken from two men just...Ch. 11 - Prob. 18PCh. 11 - a. It is possible to perform DNA fingerprinting...Ch. 11 - On July 17, 1918, Tsar Nicholas II; his wife the...Ch. 11 - The figure that follows shows DNA fingerprint...Ch. 11 - Microarrays were used to determine the genotypes...Ch. 11 - A partial sequence of the wild-type HbA allele is...Ch. 11 - a. In Fig. 11.17b, PCR is performed to amplify...Ch. 11 - The following figure shows a partial microarray...Ch. 11 - Scientists were surprised to discover recently...Ch. 11 - The microarray shown in Problem 25 analyzes...Ch. 11 - The figure that follows shows the pedigree of a...Ch. 11 - One of the difficulties faced by human geneticists...Ch. 11 - Now consider a mating between consanguineous...Ch. 11 - The pedigree shown in Fig. 11.22 was crucial to...Ch. 11 - You have identified a SNP marker that in one large...Ch. 11 - The pedigrees indicated here were obtained with...Ch. 11 - Approximately 3 of the population carries a mutant...Ch. 11 - The drug ivacaftor has recently been developed to...Ch. 11 - In the high-throughput DNA sequencing protocol...Ch. 11 - A researcher sequences the whole exome of a...Ch. 11 - As explained in the text, the cause of many...Ch. 11 - Figure 11.26 portrayed the analysis of Miller...Ch. 11 - A research paper published in the summer of 2012...Ch. 11 - Table 11.2 and Fig. 11.27 together portray the...Ch. 11 - The human RefSeq of the entire first exon of a...Ch. 11 - Mutations in the HPRT1 gene in humans result in at...Ch. 11 - Prob. 44P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Below are gel electrophoresis results for initial and nested PCR of the Shrimp Plant. Use the results to answer these questions: a) Why does the Arabidopsis control generate two PCR bands, but the plasmid control only generates one PCR band? b) Did the negative control generate a PCR product? If so, what are the implications of this for the experiment? c) Would you use this nested PCR product from Shrimp Plant for cloning? Briefly explain your answerarrow_forwardIn a typical PCR reaction what is happening in stages occurring at temperature ranges (a) 92–95°C, (b) 45–65°C, and (c) 65–75°C.arrow_forwardGenomic DNA from a family where sickle-cell disease is known to be hereditary, is digested with the restriction enzyme MstII and run in a Southern Blot. The blot is hybridised with two different 0.6 kb probes, both probes (indicated in red in the diagram below) are specific for the β-globin gene (indicated as grey arrow on the diagram below). The normal wild-type βA allele contains an MstII restriction site indicated with the asterisk (*) in the diagram below; in the mutated sickle-cell βS allele this restriction site has been lost. What size bands would you expect to see on the Southern blots using probe 1 and probe 2 for an individual with sickle cell disease (have 2 βS alleles)? Probe 1 Probe 2 (a) 0.6kb 0.6kb and 1.2kb (b) 0.6kb and 1.8kb 0.6kb, 1.2kb and 1.8kb (c) 1.2kb 0.6kb (d) 1.8kb 1.8kb a. (a) b. (b) c. (c) d. (d)arrow_forward
- A blood stain from a crime scene and blood samples from four suspects were analyzed by PCR using fluorescent primers associated with three STR loci: D3S1358, vWA, and FGA. The resulting electrophoretograms are shown below. The numbers beneath each peak identify the allele (upper box) and the height of the peak in relative fluorescence units (lower box). Solve, (a) Since everyone has two copies of each chromosome and therefore, two alleles of each gene, what accounts for the appearance ofonly one allele at some loci? (b) Which suspect is a possible source of the blood? (c) Could the suspect be identifi ed using just one of the three STR loci? (d) What can you conclude about the amount of DNA obtained from Suspect 1 compared to Suspect 4?arrow_forwardFollowing a dye terminator DNA sequencing reaction using 2',3'-dideoxynucleotide triphosphates (ddNTP's), separation of the primer reaction products was achieved using capillary gel electrophoresis. In the following example, ddATP was labeled with a 'green' fluorophore, ddTTP was labeled with 'red', ddCTP was labeled with 'black', and ddGTP was labeled with 'blue. From left to right (i.e., the shortest to longest retention time), the sequence was: AACGGTTGTCTCTGATTTGTATTATGTT. What is the sequence of the template DNA, from its 3' to 5' end? о ТTIGCCAACAGAGACTAAACATААТАСАА O TTGTATTATGTTTAGTCTCTGTTGGCAA О ААСАТААТАСАААТСAGAGAСAАССGTT O AACGGTTGTCTCTGATTTGTATTATGTTarrow_forwardA region of the genome is amplified by PCR to analyze two closely linked SNPs. PCR products from individual A were labelled with a red-fluorescing dye and those from individual B labelled with a green-fluorescing dye. These PCR products were mixed and hybridized to an oligonucleotide microarray as shown in the figure below. What can we conclude about the data shown? Select all true: a. individual A is heterozygous for the M1 and M2 haplotypes, individual B is heterozygous for M4 and M5 b. individual A is heterozygous for the M1 and M2 haplotypes, individual B is heterozygous for M3 and M6 c. Sanger sequencing traces of these PCR products would show the same double peaks at the same positions for these two individuals d. analyzing this PCR amplified region with conventional Sanger sequencing would be more accurate than the microarray analysis e. individuals A and B could be siblings who share a parent that is homozygous for one of the haplotypes {urgent}arrow_forward
- Match the PCR sample with the predicted result on the agarose gel. 1) Sample from individual homozygous for their PV92 locus with the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 2) Sample from individual homozygous for their PV92 locus without the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 3) Sample from individual heterozygous for their PV92 locus having the Alu insert. Five bands of 100, 200 500, 700 and 1000bp Single band of 300 bp Two bands one of 300 bp and one of 641bp Tow bands one of 641 bp and one of 941 bp No Bends Single band of 941 bp Single band of 641bp 4) Negative control sample. Five bands of 100, 200 500, 700 and 1000bp…arrow_forwardTraditional Sanger sequencing has largely been replaced in recent years by next-generation and third-generation sequencing approaches. Describe advantages of these sequencing methods over first-generation Sanger sequencing.arrow_forwardThis is a schematic diagram of an agarose gel used to analyze the DNA fragments generated by analyzing individual female flies with primers P1, P2, and P3 in a single PCR reaction. Lane M represents DNA fragments that are size markers (standards). In lanes 1, 2, and 3, sketch in the DNA fragments expected to be produced by PCR for female Drosophila homozygous for wild-type, heterozygous, and homozygous for the white-one mutation, respectively:arrow_forward
- DNA from 100 unrelated individuals from one population of Chinook salmon were amplified at a single microsatellite locus, and run on an agarose gel. The results from gel electrophoresis shows three different fragment lengths (i.e. alleles/band positions) corresponding to 3 alleles; Allele F (250bp), Allele R (180bp), and Allele Y (100bp). The numbers at the top of each lane is the number of fish observed with that particular genotype or banding pattern in the population. Note that a single band means a homozygote for that allele (band size). a) Calculate the allele frequency for Allele Y. (b) Calculate the genotype frequencies for the following genotypes: FF, FR, and RY. (c) What is the expected number of Chinook salmon with homozygous genotype for allele Y in the study population? (d)What is the name of the statistical test that you could conduct to test whether this population of Chinook salmon is in Hardy Weinberg Equilibriumarrow_forwardThe exponential nature of PCR allows spectacular increases in the abundanceof a DNA sequence being amplified. Consider a 10-kbp DNA sequence in agenome of 1010 base pairs. What fraction of the genome does this sequence represent? That is, what is the fractional abundance of this sequence in this genome?Calculate the fractional abundance of this target sequence after 10, 15, and 20 cycles of PCR, starting with DNA representing the whole genome and assuming that no other sequences in the genome undergo amplification in the process.arrow_forwardThe gel below shows results for the bitter tasting SNP analysis from a CH306 class from a few years ago. Analyze the results and annotate the gel to indicate the bitter tasting ability and homozygous/heterozygous status of each of the individuals represented on the gel. There are three lanes of markers, and the first non-maker lane on the left of the gel is an uncut control PCR product (i.e. there are a total of 10 individuals on the gel starting in lane 3).arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License